Back to Multiple platform build/check report for BioC 3.22: simplified long |
|
This page was generated on 2025-09-12 12:04 -0400 (Fri, 12 Sep 2025).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo2 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.5.1 Patched (2025-08-23 r88802) -- "Great Square Root" | 4715 |
lconway | macOS 12.7.1 Monterey | x86_64 | 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" | 4535 |
kjohnson3 | macOS 13.7.7 Ventura | arm64 | 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" | 4519 |
taishan | Linux (openEuler 24.03 LTS) | aarch64 | 4.5.0 (2025-04-11) -- "How About a Twenty-Six" | 4543 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 730/2322 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 2.3.5 (landing page) Changqing Wang
| nebbiolo2 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | ERROR | |||||||||
lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | ERROR | OK | |||||||||
kjohnson3 | macOS 13.7.7 Ventura / arm64 | OK | OK | ERROR | OK | |||||||||
taishan | Linux (openEuler 24.03 LTS) / aarch64 | ERROR | ERROR | skipped | ||||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 2.3.5 |
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.5.tar.gz |
StartedAt: 2025-09-11 20:52:30 -0400 (Thu, 11 Sep 2025) |
EndedAt: 2025-09-11 21:16:37 -0400 (Thu, 11 Sep 2025) |
EllapsedTime: 1446.2 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: FLAMES.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.5.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’ * using R version 4.5.1 Patched (2025-09-10 r88807) * using platform: x86_64-apple-darwin20 * R was compiled by Apple clang version 14.0.0 (clang-1400.0.29.202) GNU Fortran (GCC) 14.2.0 * running under: macOS Monterey 12.7.6 * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * this is package ‘FLAMES’ version ‘2.3.5’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... INFO Imports includes 47 non-default packages. Importing from so many packages makes the package vulnerable to any of them becoming unavailable. Move as many as possible to Suggests and use conditionally. * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .dockerignore These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ * used SDK: ‘MacOSX11.3.1.sdk’ * checking C++ specification ... OK * checking installed package size ... INFO installed size is 5.5Mb sub-directories of 1Mb or more: data 1.8Mb libs 1.8Mb * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... NOTE There are ::: calls to the package's namespace in its code. A package almost never needs to use ::: for its own objects: 'blaze' 'find_barcode' 'gene_quantification' 'isoform_identification' 'minimap2_align' 'transcript_quantification' * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE BulkPipeline: no visible global function definition for ‘new’ BulkPipeline: no visible global function definition for ‘setNames’ MultiSampleSCPipeline: no visible global function definition for ‘new’ MultiSampleSCPipeline: no visible global function definition for ‘setNames’ SingleCellPipeline: no visible global function definition for ‘new’ SingleCellPipeline: no visible global function definition for ‘setNames’ addRowRanges: no visible global function definition for ‘head’ addRowRanges: no visible global function definition for ‘as’ add_gene_counts: no visible global function definition for ‘as’ cache_dir: no visible global function definition for ‘packageVersion’ chisq_test_by_gene: no visible global function definition for ‘chisq.test’ create_sce_from_dir: no visible global function definition for ‘setNames’ create_spe: no visible binding for global variable ‘barcode’ create_spe: no visible binding for global variable ‘in_tissue’ download_oarfish: no visible global function definition for ‘download.file’ download_oarfish: no visible global function definition for ‘unzip’ filter_coverage: no visible global function definition for ‘starts_with’ filter_coverage: no visible binding for global variable ‘filter_res’ find_variants: no visible global function definition for ‘setNames’ find_variants_grange: no visible binding for global variable ‘which_label’ find_variants_grange: no visible binding for global variable ‘nucleotide’ find_variants_grange: no visible binding for global variable ‘pos’ find_variants_grange: no visible binding for global variable ‘count’ find_variants_grange: no visible binding for global variable ‘counts_no_ins’ find_variants_grange: no visible binding for global variable ‘ref’ generate_sc_sce: no visible binding for global variable ‘FSM_match’ get_coverage: no visible binding for global variable ‘Freq’ homopolymer_pct : <anonymous>: no visible binding for global variable ‘Freq’ homopolymer_pct : <anonymous>: no visible binding for global variable ‘pct’ plot_coverage: no visible binding for global variable ‘tr_length’ plot_coverage: no visible binding for global variable ‘read_counts’ plot_coverage: no visible binding for global variable ‘total_counts’ plot_coverage: no visible binding for global variable ‘cumpct’ plot_coverage: no visible binding for global variable ‘length_bin’ plot_coverage: no visible binding for global variable ‘min_length’ plot_coverage: no visible binding for global variable ‘max_length’ plot_coverage: no visible global function definition for ‘head’ plot_coverage: no visible binding for global variable ‘transcript’ plot_demultiplex_raw: no visible binding for global variable ‘Sample’ plot_demultiplex_raw: no visible binding for global variable ‘CellBarcode’ plot_demultiplex_raw: no visible binding for global variable ‘UMI’ plot_demultiplex_raw: no visible binding for global variable ‘UMI_count’ plot_demultiplex_raw: no visible binding for global variable ‘barcode_rank’ plot_demultiplex_raw: no visible binding for global variable ‘FlankEditDist’ plot_demultiplex_raw: no visible binding for global variable ‘n_reads’ plot_demultiplex_raw: no visible binding for global variable ‘BarcodeEditDist’ plot_demultiplex_raw: no visible binding for global variable ‘total reads’ plot_demultiplex_raw: no visible binding for global variable ‘demultiplexed reads’ plot_demultiplex_raw: no visible binding for global variable ‘single match reads’ plot_demultiplex_raw: no visible binding for global variable ‘undemultiplexted reads’ plot_demultiplex_raw: no visible binding for global variable ‘multi-matching reads’ plot_demultiplex_raw: no visible binding for global variable ‘Type’ plot_demultiplex_raw: no visible binding for global variable ‘Reads’ plot_demultiplex_raw: no visible binding for global variable ‘input’ plot_demultiplex_raw: no visible binding for global variable ‘output’ plot_demultiplex_raw: no visible binding for global variable ‘read1_with_adapter’ plot_demultiplex_raw: no visible binding for global variable ‘Count’ plot_flagstat: no visible global function definition for ‘everything’ plot_flagstat: no visible binding for global variable ‘name’ plot_flagstat: no visible binding for global variable ‘value’ plot_isoform_reduced_dim: no visible binding for global variable ‘x’ plot_isoform_reduced_dim: no visible binding for global variable ‘y’ plot_isoform_reduced_dim: no visible binding for global variable ‘expr’ plot_spatial: no visible binding for global variable ‘imageX’ plot_spatial: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘imageX’ plot_spatial_feature: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘x’ plot_spatial_feature: no visible binding for global variable ‘y’ plot_spatial_feature: no visible global function definition for ‘scale_alpha_continuous’ plot_spatial_feature: no visible global function definition for ‘scale_colour_gradient’ plot_spatial_isoform: no visible global function definition for ‘head’ plot_spatial_pie: no visible global function definition for ‘setNames’ plot_spatial_pie: no visible global function definition for ‘head’ plot_spatial_pie: no visible binding for global variable ‘imageX’ plot_spatial_pie: no visible binding for global variable ‘imageY’ sc_gene_entropy: no visible global function definition for ‘as’ sc_genotype: no visible binding for global variable ‘allele’ sc_genotype: no visible binding for global variable ‘allele_count’ sc_genotype: no visible binding for global variable ‘barcode’ sc_genotype: no visible binding for global variable ‘pct’ sc_mutations: no visible binding for global variable ‘mutation_index’ sc_mutations: no visible binding for global variable ‘bam_index’ sc_plot_genotype: no visible global function definition for ‘setNames’ sc_plot_genotype: no visible binding for global variable ‘barcode’ sc_plot_genotype: no visible binding for global variable ‘genotype’ sc_plot_genotype: no visible binding for global variable ‘x’ sc_plot_genotype: no visible binding for global variable ‘y’ sc_transcript_usage_chisq: no visible global function definition for ‘as’ sc_transcript_usage_chisq: no visible binding for global variable ‘p.value’ sc_transcript_usage_chisq: no visible binding for global variable ‘adj.p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘total’ sc_transcript_usage_permutation: no visible binding for global variable ‘test’ sc_transcript_usage_permutation: no visible global function definition for ‘as’ sc_transcript_usage_permutation : <anonymous>: no visible global function definition for ‘as’ sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible global function definition for ‘na.omit’ sc_transcript_usage_permutation: no visible binding for global variable ‘transcript’ sc_transcript_usage_permutation: no visible binding for global variable ‘p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘adj.p.value’ variant_count_tb: no visible binding for global variable ‘barcode’ variant_count_tb: no visible binding for global variable ‘allele_count’ variant_count_tb: no visible binding for global variable ‘cell_total_reads’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding for global variable ‘expect_cell_number’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding for global variable ‘fastq’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding for global variable ‘demultiplexed_fastq’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding for global variable ‘barcodes_file’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding for global variable ‘outdir’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global function definition for ‘setNames’ barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no visible global function definition for ‘setNames’ barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for global variable ‘expect_cell_number’ barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for global variable ‘fastq’ barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for global variable ‘demultiplexed_fastq’ barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for global variable ‘barcodes_file’ barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for global variable ‘outdir’ barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global function definition for ‘setNames’ genome_alignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘j’ genome_alignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘genome_bam’ genome_alignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘minimap2’ genome_alignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘samtools’ genome_alignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘threads’ genome_alignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘outdir’ plot_durations,FLAMES.Pipeline: no visible binding for global variable ‘step’ plot_durations,FLAMES.Pipeline: no visible binding for global variable ‘duration’ read_realignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘j’ read_realignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘transcriptome_assembly’ read_realignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘transcriptome_bam’ read_realignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘minimap2’ read_realignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘samtools’ read_realignment_raw,FLAMES.Pipeline: no visible binding for global variable ‘outdir’ resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function definition for ‘capture.output’ run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function definition for ‘capture.output’ Undefined global functions or variables: BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Reads Sample Type UMI UMI_count adj.p.value allele allele_count as bam_index barcode barcode_rank barcodes_file capture.output cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed reads demultiplexed_fastq download.file duration everything expect_cell_number expr fastq filter_res genome_bam genotype head imageX imageY in_tissue input j length_bin max_length min_length minimap2 multi-matching reads mutation_index n_reads na.omit name new nucleotide outdir output p.value packageVersion pct pos read1_with_adapter read_counts ref samtools scale_alpha_continuous scale_colour_gradient setNames single match reads starts_with step test threads total total reads total_counts tr_length transcript transcriptome_assembly transcriptome_bam undemultiplexted reads unzip value which_label x y Consider adding importFrom("base", "match", "single") importFrom("methods", "as", "new") importFrom("stats", "chisq.test", "na.omit", "setNames", "step") importFrom("utils", "capture.output", "download.file", "head", "packageVersion", "unzip") to your NAMESPACE file (and ensure that your DESCRIPTION Imports field contains 'methods'). * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... INFO GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking include directives in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs/FLAMES.so’: Found ‘___assert_rtn’, possibly from ‘assert’ (C) Found ‘___stderrp’, possibly from ‘stderr’ (C) Found ‘___stdoutp’, possibly from ‘stdout’ (C) Found ‘_abort’, possibly from ‘abort’ (C) Found ‘_exit’, possibly from ‘exit’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘FLAMES-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: plot_isoform_heatmap > ### Title: FLAMES heetmap plots > ### Aliases: plot_isoform_heatmap > > ### ** Examples > > data(scmixology_lib10_transcripts) > scmixology_lib10_transcripts |> + scuttle::logNormCounts() |> + plot_isoform_heatmap(gene = "ENSG00000108107") Error in validObject(.Object) : invalid class "GGbio" object: invalid object for slot "ggplot" in class "GGbio": got class "ggplot2::ggplot", should be or extend class "gg_OR_NULL" Calls: plot_isoform_heatmap ... <Anonymous> -> initialize -> initialize -> validObject Execution halted Examples with CPU (user + system) or elapsed time > 5s user system elapsed find_variants 26.079 0.452 25.971 MultiSampleSCPipeline 14.023 2.043 17.744 blaze 8.378 1.130 10.470 create_sce_from_dir 6.529 1.233 6.497 BulkPipeline 4.945 0.687 6.271 bulk_long_pipeline 4.633 0.991 4.369 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 1 ERROR, 5 NOTEs See ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** this is package ‘FLAMES’ version ‘2.3.5’ ** using non-staged installation via StagedInstall field ** libs /bin/sh: rustc: command not found using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ using C++17 using SDK: ‘MacOSX11.3.1.sdk’ /bin/sh: rustc: command not found clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable] unsigned int end; ^ 1 warning generated. clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi Building for x86_64 (cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2 -Wno-unused-result" minimap2) cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC main.c -o main.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC kthread.c -o kthread.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC kalloc.c -o kalloc.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC misc.c -o misc.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC bseq.c -o bseq.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC sketch.c -o sketch.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC sdust.c -o sdust.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC options.c -o options.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC index.c -o index.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC lchain.c -o lchain.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC align.c -o align.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC hit.c -o hit.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC seed.c -o seed.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC jump.c -o jump.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC map.c -o map.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC format.c -o format.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC pe.c -o pe.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC esterr.c -o esterr.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC splitidx.c -o splitidx.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -DHAVE_KALLOC ksw2_ll_sse.c -o ksw2_ll_sse.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_extz2_sse.c -o ksw2_extz2_sse41.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_extd2_sse.c -o ksw2_extd2_sse41.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_exts2_sse.c -o ksw2_exts2_sse41.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_extz2_sse.c -o ksw2_extz2_sse2.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_extd2_sse.c -o ksw2_extd2_sse2.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_exts2_sse.c -o ksw2_exts2_sse2.o cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_dispatch.c -o ksw2_dispatch.o ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o cc -falign-functions=64 -Wall -g -O2 -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread echo "Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin" Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin mkdir -p ../inst/bin cp submodule/minimap2/minimap2 ../inst/bin/ Cargo not found, skipping oarfish installation. installing to /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs ** R ** data ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices *** copying figures ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: x86_64-apple-darwin20 R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > # This file is part of the standard setup for testthat. > # It is recommended that you do not modify it. > # > # Where should you do additional test configuration? > # Learn more about the roles of various files in: > # * https://r-pkgs.org/tests.html > # * https://testthat.r-lib.org/reference/test_package.html#special-files > > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1444eec5eb0/config_file_41284.json Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1444eec5eb0/config_file_41284.json Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1444eec5eb0/config_file_41284.json Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1443e08dc3b/config_file_41284.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea14464e54822/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea14468a71389/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea14468a71389/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144520077ef/musc_rps24_1.fastq Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144520077ef/musc_rps24_2.fastq Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144520077ef/musc_rps24_3.fastq Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144520077ef/musc_rps24_4.fastq Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea14422ad1700/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 Skipping TSO trimming... Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1441a1721d5/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:01:33 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample sample1 -> /tmp/RtmpWn71Sb/filea1441a1721d5/sample1_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample2 -> /tmp/RtmpWn71Sb/filea1441a1721d5/sample2_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample3 -> /tmp/RtmpWn71Sb/filea1441a1721d5/sample3_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:01:34 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0%[21:01:42] WARNING: src/learner.cc:553: If you are loading a serialized model (like pickle in Python, RDS in R) generated by older XGBoost, please export the model by calling `Booster.save_model` from that version first, then load it back in current version. See: https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html for more details about differences between saving model and serializing. [21:01:42] WARNING: src/learner.cc:553: If you are loading a serialized model (like pickle in Python, RDS in R) generated by older XGBoost, please export the model by calling `Booster.save_model` from that version first, then load it back in current version. See: https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html for more details about differences between saving model and serializing. [21:01:42] WARNING: src/learner.cc:553: If you are loading a serialized model (like pickle in Python, RDS in R) generated by older XGBoost, please export the model by calling `Booster.save_model` from that version first, then load it back in current version. See: https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html for more details about differences between saving model and serializing. [21:01:42] WARNING: src/learner.cc:553: If you are loading a serialized model (like pickle in Python, RDS in R) generated by older XGBoost, please export the model by calling `Booster.save_model` from that version first, then load it back in current version. See: https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html for more details about differences between saving model and serializing. [21:01:44] WARNING: src/learner.cc:553: If you are loading a serialized model (like pickle in Python, RDS in R) generated by older XGBoost, please export the model by calling `Booster.save_model` from that version first, then load it back in current version. See: https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html for more details about differences between saving model and serializing. [21:01:44] WARNING: src/learner.cc:553: If you are loading a serialized model (like pickle in Python, RDS in R) generated by older XGBoost, please export the model by calling `Booster.save_model` from that version first, then load it back in current version. See: https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html for more details about differences between saving model and serializing. | |======================= | 33% | |=============================================== | 67% | |======================================================================| 100% Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:02:04 2025 ------------------- Realigning sample sample1 -> /tmp/RtmpWn71Sb/filea1441a1721d5/sample1_realign2transcript.bam Skipped sorting BAM files. Realigning sample sample2 -> /tmp/RtmpWn71Sb/filea1441a1721d5/sample2_realign2transcript.bam Skipped sorting BAM files. Realigning sample sample3 -> /tmp/RtmpWn71Sb/filea1441a1721d5/sample3_realign2transcript.bam Skipped sorting BAM files. -- Running step: transcript_quantification @ Thu Sep 11 21:02:05 2025 ---------- [2m2025-09-12T01:02:05.082078Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:02:05.082760Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441a1721d5/sample1_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:02:05.082830Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:02:05.082854Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:02:05.083038Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:02:05.083079Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:02:05.085569Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:02:05.085901Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 253 │ │ aligned fraction too low │ 4 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 1 │ │ reads with valid best alignment │ 96 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:02:05.086004Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116 [2m2025-09-12T01:02:05.086015Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96 [2m2025-09-12T01:02:05.086022Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86 [2m2025-09-12T01:02:05.089916Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:02:05.150755Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:02:05.151432Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441a1721d5/sample2_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:02:05.151480Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:02:05.151495Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:02:05.151622Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:02:05.151642Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:02:05.154384Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:02:05.154703Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 251 │ │ aligned fraction too low │ 5 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 2 │ │ reads with valid best alignment │ 95 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:02:05.154770Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114 [2m2025-09-12T01:02:05.154780Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95 [2m2025-09-12T01:02:05.154786Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82 [2m2025-09-12T01:02:05.159715Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:02:05.212370Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:02:05.213063Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441a1721d5/sample3_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:02:05.213113Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:02:05.213131Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:02:05.213272Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:02:05.213293Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:02:05.218390Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records. [2m2025-09-12T01:02:05.218760Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 398 │ │ aligned fraction too low │ 12 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 5 │ │ reads with valid best alignment │ 179 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:02:05.218835Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239 [2m2025-09-12T01:02:05.218844Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179 [2m2025-09-12T01:02:05.218851Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143 [2m2025-09-12T01:02:05.223789Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea14465c2801/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:02:06 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea14465c2801/sample1_align2genome.bam sample2 ->/tmp/RtmpWn71Sb/filea14465c2801/sample2_align2genome.bam sample3 ->/tmp/RtmpWn71Sb/filea14465c2801/sample3_align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:02:29 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |======================= | 33% | |=============================================== | 67% | |======================================================================| 100% Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:02:54 2025 ------------------- Realignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea14465c2801/sample1_realign2transcript.bam sample2 ->/tmp/RtmpWn71Sb/filea14465c2801/sample2_realign2transcript.bam sample3 ->/tmp/RtmpWn71Sb/filea14465c2801/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:03:16 2025 ---------- [2m2025-09-12T01:03:16.832712Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:03:16.833381Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14465c2801/sample1_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:03:16.833466Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:03:16.833480Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:03:16.833607Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:03:16.833624Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:03:16.836208Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:03:16.836601Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 253 │ │ aligned fraction too low │ 4 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 1 │ │ reads with valid best alignment │ 96 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:03:16.836705Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116 [2m2025-09-12T01:03:16.836738Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96 [2m2025-09-12T01:03:16.836750Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86 [2m2025-09-12T01:03:16.840185Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:03:16.888819Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:03:16.889362Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14465c2801/sample2_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:03:16.889390Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:03:16.889400Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:03:16.889494Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:03:16.889505Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:03:16.892095Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:03:16.892429Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 251 │ │ aligned fraction too low │ 5 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 2 │ │ reads with valid best alignment │ 95 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:03:16.892473Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114 [2m2025-09-12T01:03:16.892500Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95 [2m2025-09-12T01:03:16.892508Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82 [2m2025-09-12T01:03:16.896015Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:03:16.944399Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:03:16.945027Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14465c2801/sample3_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:03:16.945073Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:03:16.945089Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:03:16.945287Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:03:16.945321Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:03:16.949401Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records. [2m2025-09-12T01:03:16.949716Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 398 │ │ aligned fraction too low │ 12 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 5 │ │ reads with valid best alignment │ 179 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:03:16.949762Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239 [2m2025-09-12T01:03:16.949771Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179 [2m2025-09-12T01:03:16.949778Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143 [2m2025-09-12T01:03:16.954448Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1446cdbe38d/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:03:17 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample sample1 -> /tmp/RtmpWn71Sb/filea1446cdbe38d/sample1_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample2 -> /tmp/RtmpWn71Sb/filea1446cdbe38d/sample2_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample3 -> /tmp/RtmpWn71Sb/filea1446cdbe38d/sample3_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:03:18 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |======================= | 33% | |=============================================== | 67% | |======================================================================| 100% Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:03:41 2025 ------------------- Realigning sample sample1 -> /tmp/RtmpWn71Sb/filea1446cdbe38d/sample1_realign2transcript.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample sample2 -> /tmp/RtmpWn71Sb/filea1446cdbe38d/sample2_realign2transcript.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample sample3 -> /tmp/RtmpWn71Sb/filea1446cdbe38d/sample3_realign2transcript.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: transcript_quantification @ Thu Sep 11 21:03:42 2025 ---------- 21:03:42 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1446577456f/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:03:44 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea1446577456f/sample1_align2genome.bam sample2 ->/tmp/RtmpWn71Sb/filea1446577456f/sample2_align2genome.bam sample3 ->/tmp/RtmpWn71Sb/filea1446577456f/sample3_align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:04:07 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |======================= | 33% | |=============================================== | 67% | |======================================================================| 100% Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:04:29 2025 ------------------- Realignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea1446577456f/sample1_realign2transcript.bam sample2 ->/tmp/RtmpWn71Sb/filea1446577456f/sample2_realign2transcript.bam sample3 ->/tmp/RtmpWn71Sb/filea1446577456f/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:04:51 2025 ---------- 21:04:51 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam Inputs: ['/tmp/RtmpWn71Sb/filea1446cdbe38d/sample3_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1446cdbe38d/sample2_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1446cdbe38d/sample1_realign2transcript.bam'] /tmp/RtmpWn71Sb/filea1446cdbe38d/transcript_assembly.fa.fai 5 0.4 0.4 Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2}) Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea14463bf5390/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:04:53 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample sample1 -> /tmp/RtmpWn71Sb/filea14463bf5390/sample1_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample2 -> /tmp/RtmpWn71Sb/filea14463bf5390/sample2_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample3 -> /tmp/RtmpWn71Sb/filea14463bf5390/sample3_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:04:54 2025 ------------- Inputs: ['/tmp/RtmpWn71Sb/filea1446577456f/sample3_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1446577456f/sample2_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1446577456f/sample1_realign2transcript.bam'] /tmp/RtmpWn71Sb/filea1446577456f/transcript_assembly.fa.fai 5 0.4 0.4 Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2}) #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:04:54 2025 ------------------- Realigning sample sample1 -> /tmp/RtmpWn71Sb/filea14463bf5390/sample1_realign2transcript.bam Skipped sorting BAM files. Realigning sample sample2 -> /tmp/RtmpWn71Sb/filea14463bf5390/sample2_realign2transcript.bam Skipped sorting BAM files. Realigning sample sample3 -> /tmp/RtmpWn71Sb/filea14463bf5390/sample3_realign2transcript.bam Skipped sorting BAM files. -- Running step: transcript_quantification @ Thu Sep 11 21:04:55 2025 ---------- [2m2025-09-12T01:04:56.014464Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:04:56.015292Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14463bf5390/sample1_realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:04:56.015356Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:04:56.015377Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:04:56.015542Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:04:56.015570Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:04:56.019882Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:04:56.020178Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 707 │ │ aligned fraction too low │ 2 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 0 │ │ reads with valid best alignment │ 98 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:04:56.020247Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125 [2m2025-09-12T01:04:56.020259Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98 [2m2025-09-12T01:04:56.020265Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86 [2m2025-09-12T01:04:56.024207Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:04:56.084103Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:04:56.084852Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14463bf5390/sample2_realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:04:56.084898Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:04:56.084912Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:04:56.085075Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:04:56.085094Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:04:56.089894Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:04:56.090182Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 701 │ │ aligned fraction too low │ 3 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 0 │ │ reads with valid best alignment │ 97 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:04:56.090227Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136 [2m2025-09-12T01:04:56.090235Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97 [2m2025-09-12T01:04:56.090240Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79 [2m2025-09-12T01:04:56.095080Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:04:56.142261Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:04:56.142823Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14463bf5390/sample3_realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:04:56.142897Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:04:56.142911Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:04:56.143081Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:04:56.143102Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:04:56.149804Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:04:56.150294Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 1060 │ │ aligned fraction too low │ 6 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 0 │ │ reads with valid best alignment │ 187 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:04:56.150368Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272 [2m2025-09-12T01:04:56.150383Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187 [2m2025-09-12T01:04:56.150393Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140 [2m2025-09-12T01:04:56.154486Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea144126bba66/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:04:56 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea144126bba66/sample1_align2genome.bam sample2 ->/tmp/RtmpWn71Sb/filea144126bba66/sample2_align2genome.bam sample3 ->/tmp/RtmpWn71Sb/filea144126bba66/sample3_align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:05:19 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:05:20 2025 ------------------- Realignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea144126bba66/sample1_realign2transcript.bam sample2 ->/tmp/RtmpWn71Sb/filea144126bba66/sample2_realign2transcript.bam sample3 ->/tmp/RtmpWn71Sb/filea144126bba66/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:05:43 2025 ---------- [2m2025-09-12T01:05:43.772817Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:05:43.773588Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144126bba66/sample1_realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:05:43.773639Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:05:43.773658Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:05:43.773925Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:05:43.773960Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:05:43.777269Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:05:43.777618Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 707 │ │ aligned fraction too low │ 2 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 0 │ │ reads with valid best alignment │ 98 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:05:43.777691Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125 [2m2025-09-12T01:05:43.777703Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98 [2m2025-09-12T01:05:43.777713Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86 [2m2025-09-12T01:05:43.782767Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:05:43.834827Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:05:43.835524Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144126bba66/sample2_realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:05:43.835567Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:05:43.835581Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:05:43.835755Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:05:43.835778Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:05:43.839951Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:05:43.840312Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 701 │ │ aligned fraction too low │ 3 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 0 │ │ reads with valid best alignment │ 97 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:05:43.840413Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136 [2m2025-09-12T01:05:43.840430Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97 [2m2025-09-12T01:05:43.840442Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79 [2m2025-09-12T01:05:43.845814Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. [2m2025-09-12T01:05:43.903394Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:05:43.904165Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144126bba66/sample3_realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:05:43.904208Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:05:43.904223Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:05:43.904413Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:05:43.904434Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:05:43.911892Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records. [2m2025-09-12T01:05:43.912312Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m discard_table: ╭─────────────────────────────────┬───────╮ │ reason │ count │ ├─────────────────────────────────┼───────┤ │ too far from 5' end │ 0 │ │ too far from 3' end │ 0 │ │ score too low │ 1060 │ │ aligned fraction too low │ 6 │ │ aligned length too short │ 0 │ │ inconsistent orientation │ 0 │ │ supplementary alignment │ 0 │ │ reads with valid best alignment │ 187 │ ╰─────────────────────────────────┴───────╯ [2m2025-09-12T01:05:43.912367Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272 [2m2025-09-12T01:05:43.912376Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187 [2m2025-09-12T01:05:43.912382Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140 [2m2025-09-12T01:05:43.915931Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully. Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1441de06a9e/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:05:44 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample sample1 -> /tmp/RtmpWn71Sb/filea1441de06a9e/sample1_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample2 -> /tmp/RtmpWn71Sb/filea1441de06a9e/sample2_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample sample3 -> /tmp/RtmpWn71Sb/filea1441de06a9e/sample3_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:05:45 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:05:46 2025 ------------------- Realigning sample sample1 -> /tmp/RtmpWn71Sb/filea1441de06a9e/sample1_realign2transcript.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample sample2 -> /tmp/RtmpWn71Sb/filea1441de06a9e/sample2_realign2transcript.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample sample3 -> /tmp/RtmpWn71Sb/filea1441de06a9e/sample3_realign2transcript.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: transcript_quantification @ Thu Sep 11 21:05:47 2025 ---------- 21:05:47 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1446bf8cfba/config_file_41284.json Configured steps: genome_alignment: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: genome_alignment @ Thu Sep 11 21:05:48 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea1446bf8cfba/sample1_align2genome.bam sample2 ->/tmp/RtmpWn71Sb/filea1446bf8cfba/sample2_align2genome.bam sample3 ->/tmp/RtmpWn71Sb/filea1446bf8cfba/sample3_align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:06:11 2025 ------------- Inputs: ['/tmp/RtmpWn71Sb/filea1441de06a9e/sample3_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1441de06a9e/sample2_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1441de06a9e/sample1_realign2transcript.bam'] /tmp/RtmpWn71Sb/filea1441de06a9e/transcript_assembly.fa.fai 5 0.4 0.4 Counter({'counted_reads': 391, 'not_enough_coverage': 2}) #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:06:12 2025 ------------------- Realignment complete for the following samples: sample1 ->/tmp/RtmpWn71Sb/filea1446bf8cfba/sample1_realign2transcript.bam sample2 ->/tmp/RtmpWn71Sb/filea1446bf8cfba/sample2_realign2transcript.bam sample3 ->/tmp/RtmpWn71Sb/filea1446bf8cfba/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:06:34 2025 ---------- 21:06:34 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam Inputs: ['/tmp/RtmpWn71Sb/filea1446bf8cfba/sample3_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1446bf8cfba/sample2_realign2transcript.bam', '/tmp/RtmpWn71Sb/filea1446bf8cfba/sample1_realign2transcript.bam'] /tmp/RtmpWn71Sb/filea1446bf8cfba/transcript_assembly.fa.fai 5 0.4 0.4 Counter({'counted_reads': 391, 'not_enough_coverage': 2}) Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1444b290e7c/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:06:35 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444b290e7c/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:06:35 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea1444b290e7c/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1444b290e7c/align2genome.bam Sorting BAM files by genome coordinates with 8 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:06:36 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:06:46 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444b290e7c/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444b290e7c/matched_reads_dedup.fastq.gz files not found Realigning sample /tmp/RtmpWn71Sb/filea1444b290e7c/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1444b290e7c/realign2transcript.bam Sorting BAM files by 8 with CB threads... [bam_sort_core] merging from 0 files and 8 in-memory blocks... -- Running step: transcript_quantification @ Thu Sep 11 21:06:47 2025 ---------- [2m2025-09-12T01:06:47.382996Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:06:47.383630Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1444b290e7c/realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:06:47.383673Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:06:47.383684Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:06:47.383788Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:06:47.383800Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:06:47.391925Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1445b2705c8/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:06:48 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445b2705c8/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:06:48 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea1445b2705c8/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1445b2705c8/align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:07:11 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:07:23 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445b2705c8/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445b2705c8/matched_reads_dedup.fastq.gz files not found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea1445b2705c8/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1445b2705c8/realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:07:45 2025 ---------- [2m2025-09-12T01:07:45.540724Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:07:45.541472Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1445b2705c8/realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:07:45.541524Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:07:45.541542Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:07:45.541677Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:07:45.541699Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:07:45.549902Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea14427a2cd71/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:07:46 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea14427a2cd71/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:07:46 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea14427a2cd71/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea14427a2cd71/align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 8 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:07:47 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:07:58 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea14427a2cd71/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea14427a2cd71/matched_reads_dedup.fastq.gz files not found Realigning sample /tmp/RtmpWn71Sb/filea14427a2cd71/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea14427a2cd71/realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 8 threads... [bam_sort_core] merging from 0 files and 8 in-memory blocks... Indexing bam files -- Running step: transcript_quantification @ Thu Sep 11 21:07:58 2025 ---------- 21:07:58 Thu Sep 11 2025 quantify transcripts Found realignment file(s): realign2transcript.bam Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1442af22b8e/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:07:59 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1442af22b8e/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:08:00 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea1442af22b8e/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1442af22b8e/align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:08:22 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:08:33 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1442af22b8e/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1442af22b8e/matched_reads_dedup.fastq.gz files not found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea1442af22b8e/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1442af22b8e/realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:08:54 2025 ---------- 21:08:54 Thu Sep 11 2025 quantify transcripts Found realignment file(s): realign2transcript.bam Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6}) Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea14437409508/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:08:55 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea14437409508/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:08:55 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea14437409508/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea14437409508/align2genome.bam Sorting BAM files by genome coordinates with 8 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:08:56 2025 ------------- Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6}) #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:08:56 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea14437409508/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea14437409508/matched_reads_dedup.fastq.gz files not found Realigning sample /tmp/RtmpWn71Sb/filea14437409508/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea14437409508/realign2transcript.bam Sorting BAM files by 8 with CB threads... [bam_sort_core] merging from 0 files and 8 in-memory blocks... -- Running step: transcript_quantification @ Thu Sep 11 21:08:57 2025 ---------- [2m2025-09-12T01:08:57.107030Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:08:57.107715Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea14437409508/realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:08:57.107748Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:08:57.107759Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:08:57.107877Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:08:57.107895Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:08:57.120432Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1442ca4d5d1/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:08:58 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1442ca4d5d1/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:08:58 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea1442ca4d5d1/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1442ca4d5d1/align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:09:21 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:09:21 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1442ca4d5d1/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1442ca4d5d1/matched_reads_dedup.fastq.gz files not found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea1442ca4d5d1/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1442ca4d5d1/realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:09:43 2025 ---------- [2m2025-09-12T01:09:43.724477Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:09:43.725293Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1442ca4d5d1/realign2transcript.bam, contains 10 reference sequences. [2m2025-09-12T01:09:43.725340Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:09:43.725362Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:09:43.725558Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:09:43.725580Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts. [2m2025-09-12T01:09:43.737031Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea144333c9637/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:09:44 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144333c9637/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:09:45 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea144333c9637/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea144333c9637/align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 8 threads... Indexing bam files -- Running step: isoform_identification @ Thu Sep 11 21:09:45 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:09:46 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144333c9637/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144333c9637/matched_reads_dedup.fastq.gz files not found Realigning sample /tmp/RtmpWn71Sb/filea144333c9637/matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea144333c9637/realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 8 threads... [bam_sort_core] merging from 0 files and 8 in-memory blocks... Indexing bam files -- Running step: transcript_quantification @ Thu Sep 11 21:09:46 2025 ---------- 21:09:46 Thu Sep 11 2025 quantify transcripts Found realignment file(s): realign2transcript.bam Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea144531f3072/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: FALSE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:09:47 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 8 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144531f3072/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 -- Running step: genome_alignment @ Thu Sep 11 21:09:48 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea144531f3072/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea144531f3072/align2genome.bam -- Running step: isoform_identification @ Thu Sep 11 21:10:09 2025 ------------- Counter({'counted_reads': 368, 'unmapped': 4}) #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:10:09 2025 ------------------- Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144531f3072/matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144531f3072/matched_reads_dedup.fastq.gz files not found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea144531f3072/matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea144531f3072/realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:10:31 2025 ---------- 21:10:31 Thu Sep 11 2025 quantify transcripts Found realignment file(s): realign2transcript.bam Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea144531ce67e/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:10:33 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144531ce67e/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144531ce67e/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144531ce67e/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144531ce67e/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:10:34 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea144531ce67e/sample1_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sample1_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea144531ce67e/sample2_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sample2_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea144531ce67e/sample3_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sample3_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: gene_quantification @ Thu Sep 11 21:10:36 2025 ---------------- 21:10:36 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea144531ce67e/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea144531ce67e/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea144531ce67e/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea144531ce67e/sample3_align2genome.bam' Counter({'counted_reads': 368, 'unmapped': 4}) parsing /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 15.94gene_group/s] 2025-09-11 21:10:38.346 R[41284:263844467] XType: com.apple.fonts is not accessible. 2025-09-11 21:10:38.346 R[41284:263844467] XType: XTFontStaticRegistry is enabled. Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 385690.22Read/s] parsing /tmp/RtmpWn71Sb/filea144531ce67e/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 37.76gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1333896.45Read/s] parsing /tmp/RtmpWn71Sb/filea144531ce67e/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 38.03gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1243714.86Read/s] parsing /tmp/RtmpWn71Sb/filea144531ce67e/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 23.94gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 581411.70Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:10:39 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |================== | 25% | |=================================== | 50% | |==================================================== | 75% | |======================================================================| 100% Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:11:06 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144531ce67e/fastq, /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea144531ce67e/sample3_matched_reads_dedup.fastq.gz files found Realigning sample /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_realign2transcript.bam Sorting BAM files by 1 with CB threads... Realigning sample /tmp/RtmpWn71Sb/filea144531ce67e/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sample1_realign2transcript.bam Sorting BAM files by 1 with CB threads... Realigning sample /tmp/RtmpWn71Sb/filea144531ce67e/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sample2_realign2transcript.bam Sorting BAM files by 1 with CB threads... Realigning sample /tmp/RtmpWn71Sb/filea144531ce67e/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea144531ce67e/sample3_realign2transcript.bam Sorting BAM files by 1 with CB threads... -- Running step: transcript_quantification @ Thu Sep 11 21:11:07 2025 ---------- [2m2025-09-12T01:11:07.602152Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:11:07.602861Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144531ce67e/sampleA_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:11:07.602913Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:11:07.602932Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:11:07.603092Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:11:07.603115Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:11:07.611849Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. [2m2025-09-12T01:11:07.981566Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:11:07.982177Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144531ce67e/sample1_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:11:07.982217Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:11:07.982230Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:11:07.982346Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:11:07.982365Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:11:08.364235Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:11:08.364763Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144531ce67e/sample2_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:11:08.364800Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:11:08.364820Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:11:08.364930Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:11:08.364952Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:11:08.776824Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:11:08.777518Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea144531ce67e/sample3_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:11:08.777556Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:11:08.777575Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:11:08.777684Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:11:08.777704Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1444e002c30/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:11:09 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444e002c30/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444e002c30/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444e002c30/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444e002c30/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:11:11 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea1444e002c30/sampleA_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sampleA_align2genome.bam /tmp/RtmpWn71Sb/filea1444e002c30/sample1_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sample1_align2genome.bam /tmp/RtmpWn71Sb/filea1444e002c30/sample2_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sample2_align2genome.bam /tmp/RtmpWn71Sb/filea1444e002c30/sample3_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sample3_align2genome.bam -- Running step: gene_quantification @ Thu Sep 11 21:11:34 2025 ---------------- 21:11:34 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea1444e002c30/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea1444e002c30/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea1444e002c30/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea1444e002c30/sample3_align2genome.bam' parsing /tmp/RtmpWn71Sb/filea1444e002c30/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 15.63gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 320469.44Read/s] parsing /tmp/RtmpWn71Sb/filea1444e002c30/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 32.46gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1112547.48Read/s] parsing /tmp/RtmpWn71Sb/filea1444e002c30/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 44.38gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1212927.70Read/s] parsing /tmp/RtmpWn71Sb/filea1444e002c30/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 26.37gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 661687.39Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:11:35 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |================== | 25% | |=================================== | 50% | |==================================================== | 75% | |======================================================================| 100% Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:12:02 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444e002c30/fastq, /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444e002c30/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444e002c30/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1444e002c30/sample3_matched_reads_dedup.fastq.gz files found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea1444e002c30/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sampleA_realign2transcript.bam /tmp/RtmpWn71Sb/filea1444e002c30/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sample1_realign2transcript.bam /tmp/RtmpWn71Sb/filea1444e002c30/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sample2_realign2transcript.bam /tmp/RtmpWn71Sb/filea1444e002c30/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1444e002c30/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:12:25 2025 ---------- [2m2025-09-12T01:12:25.358489Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:12:25.359188Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1444e002c30/sampleA_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:12:25.359238Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:12:25.359258Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:12:25.359398Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:12:25.359427Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:12:25.367424Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. [2m2025-09-12T01:12:25.845659Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:12:25.853318Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1444e002c30/sample1_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:12:25.860549Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:12:25.860582Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:12:25.860772Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:12:25.860802Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:12:26.339555Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:12:26.340336Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1444e002c30/sample2_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:12:26.340387Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:12:26.340404Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:12:26.340545Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:12:26.340725Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. [2m2025-09-12T01:12:26.877900Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:12:26.878411Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1444e002c30/sample3_realign2transcript.bam, contains 5 reference sequences. [2m2025-09-12T01:12:26.878443Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:12:26.878456Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:12:26.878554Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:12:26.878571Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts. Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1445b120ac4/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:12:28 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445b120ac4/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445b120ac4/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445b120ac4/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445b120ac4/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:12:29 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: gene_quantification @ Thu Sep 11 21:12:31 2025 ---------------- 21:12:31 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea1445b120ac4/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea1445b120ac4/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea1445b120ac4/sample3_align2genome.bam' parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 16.46gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 384855.02Read/s] parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 36.62gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1538629.49Read/s] parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 45.60gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1030541.52Read/s] parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 34.85gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 701858.10Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:12:32 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |================== | 25% | |=================================== | 50% | |==================================================== | 75% | |======================================================================| 100% Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:13:00 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445b120ac4/fastq, /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_matched_reads_dedup.fastq.gz files found Realigning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: transcript_quantification @ Thu Sep 11 21:13:01 2025 ---------- 21:13:01 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam sampleA_realign2transcript.bam parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample3_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445b120ac4/sample3_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445b120ac4/sampleA_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample2_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445b120ac4/sample2_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445b120ac4/sample1_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445b120ac4/sample1_realign2transcript.bamdone annotate_full_splice_match_all_sample... Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea144e8888/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:13:04 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144e8888/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144e8888/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144e8888/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea144e8888/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144e8888/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144e8888/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144e8888/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144e8888/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea144e8888/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea144e8888/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:13:05 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea144e8888/sampleA_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sampleA_align2genome.bam /tmp/RtmpWn71Sb/filea144e8888/sample1_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sample1_align2genome.bam /tmp/RtmpWn71Sb/filea144e8888/sample2_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sample2_align2genome.bam /tmp/RtmpWn71Sb/filea144e8888/sample3_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sample3_align2genome.bam -- Running step: gene_quantification @ Thu Sep 11 21:13:28 2025 ---------------- 21:13:28 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea144e8888/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea144e8888/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea144e8888/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea144e8888/sample3_align2genome.bam' Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2}) Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2}) Counter({'counted_reads': 92, 'not_enough_coverage': 3}) Counter({'counted_reads': 89, 'not_enough_coverage': 2}) parsing /tmp/RtmpWn71Sb/filea144e8888/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 19.57gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 325563.84Read/s] parsing /tmp/RtmpWn71Sb/filea144e8888/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 48.77gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1486920.02Read/s] parsing /tmp/RtmpWn71Sb/filea144e8888/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 36.98gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1257436.14Read/s] parsing /tmp/RtmpWn71Sb/filea144e8888/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 31.00gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 658611.90Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:13:29 2025 ------------- Unzipping annotation file for bambu --- Start generating read class files --- | | | 0% | |================== | 25% | |=================================== | 50% | |==================================================== | 75% | |======================================================================| 100% Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings --- Start extending annotations --- WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization. NDR will be approximated as: (1 - Transcript Model Prediction Score) For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations --- Start isoform quantification --- --- Finished running Bambu --- -- Running step: read_realignment @ Thu Sep 11 21:13:54 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144e8888/fastq, /tmp/RtmpWn71Sb/filea144e8888/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea144e8888/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea144e8888/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144e8888/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea144e8888/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea144e8888/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea144e8888/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea144e8888/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea144e8888/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea144e8888/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea144e8888/sample3_matched_reads_dedup.fastq.gz files found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea144e8888/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sampleA_realign2transcript.bam /tmp/RtmpWn71Sb/filea144e8888/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sample1_realign2transcript.bam /tmp/RtmpWn71Sb/filea144e8888/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sample2_realign2transcript.bam /tmp/RtmpWn71Sb/filea144e8888/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea144e8888/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:14:16 2025 ---------- 21:14:16 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam sampleA_realign2transcript.bam parsing /tmp/RtmpWn71Sb/filea144e8888/sample3_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea144e8888/sample3_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea144e8888/sample3_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea144e8888/sampleA_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea144e8888/sampleA_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea144e8888/sampleA_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea144e8888/sample2_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea144e8888/sample2_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea144e8888/sample2_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea144e8888/sample1_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea144e8888/sample1_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea144e8888/sample1_realign2transcript.bamdone annotate_full_splice_match_all_sample... Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1446938085f/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:14:19 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1446938085f/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1446938085f/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1446938085f/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1446938085f/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:14:21 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea1446938085f/sampleA_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sampleA_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1446938085f/sample1_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sample1_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1446938085f/sample2_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sample2_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1446938085f/sample3_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sample3_align2genome.bam Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: gene_quantification @ Thu Sep 11 21:14:23 2025 ---------------- 21:14:23 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea1446938085f/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea1446938085f/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea1446938085f/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea1446938085f/sample3_align2genome.bam' Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2}) Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2}) Counter({'counted_reads': 92, 'not_enough_coverage': 3}) Counter({'counted_reads': 89, 'not_enough_coverage': 2}) parsing /tmp/RtmpWn71Sb/filea1446938085f/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 24.61gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 311649.53Read/s] parsing /tmp/RtmpWn71Sb/filea1446938085f/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 49.98gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1416420.37Read/s] parsing /tmp/RtmpWn71Sb/filea1446938085f/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 52.77gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1263344.58Read/s] parsing /tmp/RtmpWn71Sb/filea1446938085f/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 34.24gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 767400.47Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:14:24 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:14:24 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1446938085f/fastq, /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea1446938085f/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1446938085f/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1446938085f/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1446938085f/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1446938085f/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1446938085f/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1446938085f/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1446938085f/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1446938085f/sample3_matched_reads_dedup.fastq.gz files found Realigning sample /tmp/RtmpWn71Sb/filea1446938085f/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sampleA_realign2transcript.bam Sorting BAM files by 1 with CB threads... Realigning sample /tmp/RtmpWn71Sb/filea1446938085f/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sample1_realign2transcript.bam Sorting BAM files by 1 with CB threads... Realigning sample /tmp/RtmpWn71Sb/filea1446938085f/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sample2_realign2transcript.bam Sorting BAM files by 1 with CB threads... Realigning sample /tmp/RtmpWn71Sb/filea1446938085f/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1446938085f/sample3_realign2transcript.bam Sorting BAM files by 1 with CB threads... -- Running step: transcript_quantification @ Thu Sep 11 21:14:26 2025 ---------- [2m2025-09-12T01:14:26.761736Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:14:26.762248Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1446938085f/sampleA_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:14:26.762298Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:14:26.762319Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:14:26.762458Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:14:26.762476Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. [2m2025-09-12T01:14:26.779392Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. [2m2025-09-12T01:14:27.399006Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:14:27.399686Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1446938085f/sample1_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:14:27.399726Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:14:27.399739Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:14:27.399882Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:14:27.399900Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. [2m2025-09-12T01:14:28.046287Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:14:28.046958Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1446938085f/sample2_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:14:28.046998Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:14:28.047013Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:14:28.047150Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:14:28.047172Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. [2m2025-09-12T01:14:28.667349Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:14:28.667978Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1446938085f/sample3_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:14:28.668019Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:14:28.668033Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:14:28.668186Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:14:28.668204Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1441c91013c/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:14:29 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1441c91013c/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1441c91013c/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1441c91013c/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1441c91013c/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:14:31 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea1441c91013c/sampleA_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sampleA_align2genome.bam /tmp/RtmpWn71Sb/filea1441c91013c/sample1_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sample1_align2genome.bam /tmp/RtmpWn71Sb/filea1441c91013c/sample2_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sample2_align2genome.bam /tmp/RtmpWn71Sb/filea1441c91013c/sample3_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sample3_align2genome.bam -- Running step: gene_quantification @ Thu Sep 11 21:14:54 2025 ---------------- 21:14:54 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea1441c91013c/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea1441c91013c/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea1441c91013c/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea1441c91013c/sample3_align2genome.bam' parsing /tmp/RtmpWn71Sb/filea1441c91013c/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 15.41gene_group/s] /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/python/count_gene.py:705: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`. plt.figure(figsize=(8, 6)) Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 357912.41Read/s] parsing /tmp/RtmpWn71Sb/filea1441c91013c/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 33.28gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 857029.83Read/s] parsing /tmp/RtmpWn71Sb/filea1441c91013c/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 35.20gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1111603.94Read/s] parsing /tmp/RtmpWn71Sb/filea1441c91013c/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 24.71gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 612164.17Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:14:55 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:14:55 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1441c91013c/fastq, /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1441c91013c/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1441c91013c/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1441c91013c/sample3_matched_reads_dedup.fastq.gz files found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea1441c91013c/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sampleA_realign2transcript.bam /tmp/RtmpWn71Sb/filea1441c91013c/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sample1_realign2transcript.bam /tmp/RtmpWn71Sb/filea1441c91013c/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sample2_realign2transcript.bam /tmp/RtmpWn71Sb/filea1441c91013c/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1441c91013c/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:15:19 2025 ---------- [2m2025-09-12T01:15:19.654674Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:15:19.655379Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441c91013c/sampleA_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:15:19.655419Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:15:19.655434Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:15:19.655570Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:15:19.655588Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. [2m2025-09-12T01:15:19.672029Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells. [2m2025-09-12T01:15:20.517997Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:15:20.518750Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441c91013c/sample1_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:15:20.518806Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:15:20.518828Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:15:20.519020Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:15:20.519048Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. [2m2025-09-12T01:15:21.283380Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:15:21.284065Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441c91013c/sample2_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:15:21.284113Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:15:21.284128Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:15:21.284297Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:15:21.284322Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. [2m2025-09-12T01:15:21.994957Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters. [2m2025-09-12T01:15:21.995559Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpWn71Sb/filea1441c91013c/sample3_realign2transcript.bam, contains 14 reference sequences. [2m2025-09-12T01:15:21.995593Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding. [2m2025-09-12T01:15:21.995605Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest [2m2025-09-12T01:15:21.995735Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest [2m2025-09-12T01:15:21.995754Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts. Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1444f0515b6/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:15:23 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444f0515b6/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444f0515b6/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444f0515b6/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1444f0515b6/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:15:25 2025 ------------------- Creating junction bed file from GFF3 annotation. Aligning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Aligning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_matched_reads.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_align2genome.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: gene_quantification @ Thu Sep 11 21:15:27 2025 ---------------- 21:15:27 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea1444f0515b6/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea1444f0515b6/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea1444f0515b6/sample3_align2genome.bam' parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 16.29gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 343547.61Read/s] parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 46.60gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1237549.86Read/s] parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 44.73gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1268387.57Read/s] parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 6.50gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 6.48gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 629548.51Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:15:28 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:15:28 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444f0515b6/fastq, /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_matched_reads_dedup.fastq.gz files found Realigning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files Realigning sample /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_realign2transcript.bam Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output. Sorting BAM files by genome coordinates with 1 threads... Indexing bam files -- Running step: transcript_quantification @ Thu Sep 11 21:15:30 2025 ---------- 21:15:30 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam sampleA_realign2transcript.bam parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample3_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1444f0515b6/sample3_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1444f0515b6/sampleA_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample2_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1444f0515b6/sample2_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1444f0515b6/sample1_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1444f0515b6/sample1_realign2transcript.bamdone annotate_full_splice_match_all_sample... Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none) Writing configuration parameters to: /tmp/RtmpWn71Sb/filea1445d00fdb8/config_file_41284.json Configured steps: barcode_demultiplex: TRUE genome_alignment: TRUE gene_quantification: TRUE isoform_identification: TRUE read_realignment: TRUE transcript_quantification: TRUE samtools not found, will use Rsamtools package instead -- Running step: barcode_demultiplex @ Thu Sep 11 21:15:34 2025 ---------------- Using flexiplex for barcode demultiplexing. FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445d00fdb8/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample1.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample2.fq.gz Searching for barcodes... Processing file: /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Reads Barcodes 10 2 9 2 8 5 7 4 6 3 5 7 4 14 3 14 2 29 1 57 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445d00fdb8/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample1.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 92 Number of reads with exactly one barcode match: 91 Number of chimera reads: 1 All done! Reads Barcodes 4 1 3 9 2 9 1 44 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445d00fdb8/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample2.fq.gz Searching for barcodes... Number of reads processed: 100 Number of reads where at least one barcode was found: 95 Number of reads with exactly one barcode match: 94 Number of chimera reads: 0 All done! Reads Barcodes 4 2 3 3 2 16 1 47 FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpWn71Sb/filea1445d00fdb8/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample3.fq.gz Searching for barcodes... Number of reads processed: 193 Number of reads where at least one barcode was found: 181 Number of reads with exactly one barcode match: 179 Number of chimera reads: 0 All done! Reads Barcodes 7 1 6 1 5 1 4 7 3 10 2 27 1 53 -- Running step: genome_alignment @ Thu Sep 11 21:15:36 2025 ------------------- Creating junction bed file from GFF3 annotation. Alignment complete for the following samples: /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_align2genome.bam /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_align2genome.bam /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_align2genome.bam /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_matched_reads.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_align2genome.bam -- Running step: gene_quantification @ Thu Sep 11 21:15:58 2025 ---------------- 21:15:58 Thu Sep 11 2025 quantify genes Using BAM(s): '/tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_align2genome.bam', '/tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_align2genome.bam', '/tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_align2genome.bam', and '/tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_align2genome.bam' Counter({'counted_reads': 176}) Counter({'counted_reads': 358}) Counter({'counted_reads': 95}) Counter({'counted_reads': 91}) parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 18.31gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 332754.51Read/s] parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 41.32gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 987452.68Read/s] parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 32.11gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 1473132.90Read/s] parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_align2genome.bam... Assigning reads to genes... Processed: 0%| | 0/1 [00:00<?, ?gene_group/s] Processed: 100%|██████████| 1/1 [00:00<00:00, 23.64gene_group/s] Writing the gene count matrix ... Plotting the saturation curve ... Generating deduplicated fastq file ... Processed: 0Read [00:00, ?Read/s] Processed: 2500.0Read [00:00, 820161.13Read/s] -- Running step: isoform_identification @ Thu Sep 11 21:16:00 2025 ------------- #### Read gene annotations Removed similar transcripts in gene annotation: Counter() #### find isoforms chr14 -- Running step: read_realignment @ Thu Sep 11 21:16:00 2025 ------------------- Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq, /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample1.fq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample2.fq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/fastq/sample3.fq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_matched_reads.fastq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_matched_reads.fastq.gz files found Checking for fastq file(s) /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_matched_reads_dedup.fastq.gz files found Realignment complete for the following samples: /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_realign2transcript.bam /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_realign2transcript.bam /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_realign2transcript.bam /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_realign2transcript.bam -- Running step: transcript_quantification @ Thu Sep 11 21:16:23 2025 ---------- 21:16:23 Thu Sep 11 2025 quantify transcripts Found realignment file(s): sample1_realign2transcript.bam sample2_realign2transcript.bam sample3_realign2transcript.bam sampleA_realign2transcript.bam parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445d00fdb8/sample3_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445d00fdb8/sampleA_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445d00fdb8/sample2_realign2transcript.bamdone parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_realign2transcript.bam... parsing /tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_realign2transcript.bamdone wrt_tr_to_csv for/tmp/RtmpWn71Sb/filea1445d00fdb8/sample1_realign2transcript.bamdone annotate_full_splice_match_all_sample... [ FAIL 0 | WARN 183 | SKIP 0 | PASS 59 ] [ FAIL 0 | WARN 183 | SKIP 0 | PASS 59 ] Counter({'counted_reads': 176}) Counter({'counted_reads': 358}) Counter({'counted_reads': 95}) Counter({'counted_reads': 91}) > > proc.time() user system elapsed 829.015 54.902 919.149 /Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown warnings.warn('resource_tracker: There appear to be %d '
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
BulkPipeline | 4.945 | 0.687 | 6.271 | |
MultiSampleSCPipeline | 14.023 | 2.043 | 17.744 | |
SingleCellPipeline | 3.984 | 0.306 | 3.168 | |
add_gene_counts | 0.382 | 0.008 | 0.393 | |
annotation_to_fasta | 0.264 | 0.007 | 0.273 | |
blaze | 8.378 | 1.130 | 10.470 | |
bulk_long_pipeline | 4.633 | 0.991 | 4.369 | |
combine_sce | 1.009 | 0.087 | 1.108 | |
config-set | 0.284 | 0.144 | 0.452 | |
config | 0.278 | 0.145 | 0.450 | |
controllers-set | 0.442 | 0.069 | 0.541 | |
controllers | 0.347 | 0.165 | 0.541 | |
convolution_filter | 0.001 | 0.001 | 0.001 | |
create_config | 0.013 | 0.003 | 0.016 | |
create_sce_from_dir | 6.529 | 1.233 | 6.497 | |
create_se_from_dir | 3.216 | 0.637 | 4.136 | |
cutadapt | 0.148 | 0.050 | 0.216 | |
example_pipeline | 0.348 | 0.037 | 0.412 | |
experiment | 2.885 | 0.415 | 3.555 | |
filter_annotation | 0.061 | 0.005 | 0.066 | |
filter_coverage | 1.403 | 0.247 | 1.756 | |
find_barcode | 1.859 | 0.284 | 2.328 | |
find_bin | 0.006 | 0.011 | 0.030 | |
find_variants | 26.079 | 0.452 | 25.971 | |
get_coverage | 1.303 | 0.228 | 1.684 | |
index_genome | 0.282 | 0.154 | 0.507 | |
mutation_positions | 1.541 | 0.020 | 1.570 | |
plot_coverage | 3.224 | 0.320 | 3.665 | |
plot_demultiplex | 3.282 | 0.437 | 4.470 | |
plot_demultiplex_raw | 1.882 | 0.092 | 2.169 | |
plot_durations | 2.838 | 0.374 | 3.468 | |