Multiple platform build/check report for BioC 3.23 - CHECK results for FLAMES on kjohnson3

Hostname	OS	Arch (*)	R version	Installed pkgs
nebbiolo1	Linux (Ubuntu 24.04.3 LTS)	x86_64	R Under development (unstable) (2025-10-20 r88955) -- "Unsuffered Consequences"	4874
kjohnson3	macOS 13.7.7 Ventura	arm64	R Under development (unstable) (2025-11-04 r88984) -- "Unsuffered Consequences"	4582
Click on any hostname to see more info about the system (e.g. compilers) () as reported by 'uname -p', except on Windows and Mac OS X*

CHECK results for FLAMES on kjohnson3

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results

Summary

Package: FLAMES

Version: 2.5.1

Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.5.1.tar.gz

StartedAt: 2025-12-11 19:57:20 -0500 (Thu, 11 Dec 2025)

EndedAt: 2025-12-11 20:05:01 -0500 (Thu, 11 Dec 2025)

EllapsedTime: 460.8 seconds

RetCode: 1

Status: ERROR

CheckDir: FLAMES.Rcheck

Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.5.1.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck’
* using R Under development (unstable) (2025-11-04 r88984)
* using platform: aarch64-apple-darwin20
* R was compiled by
    Apple clang version 16.0.0 (clang-1600.0.26.6)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Ventura 13.7.8
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.5.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .dockerignore
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.1.0.2.5)’
* used SDK: ‘MacOSX11.3.1.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is 11.0Mb
  sub-directories of 1Mb or more:
    bin    6.1Mb
    data   1.8Mb
    libs   1.6Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  'blaze' 'find_barcode' 'gene_quantification' 'isoform_identification'
  'minimap2_align' 'transcript_quantification'
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
  ‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
  ‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_sce_from_dir: no visible global function definition for
  ‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable
  ‘CellBarcode’
plot_demultiplex_raw: no visible binding for global variable ‘UMI’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘BarcodeEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_gene_entropy: no visible global function definition for ‘as’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
  function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
  visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
  function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Reads
  Sample Type UMI UMI_count adj.p.value allele allele_count as
  bam_index barcode barcode_rank barcodes_file capture.output
  cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed
  reads demultiplexed_fastq download.file duration everything
  expect_cell_number expr fastq filter_res genome_bam genotype head
  imageX imageY in_tissue input j length_bin max_length min_length
  minimap2 multi-matching reads mutation_index n_reads na.omit name new
  nucleotide outdir output p.value packageVersion pct pos
  read1_with_adapter read_counts ref samtools scale_alpha_continuous
  scale_colour_gradient setNames single match reads starts_with step
  test threads total total reads total_counts tr_length transcript
  transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
  value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
plot_isoform_reduced_dim     10.225  0.106  10.916
sc_long_multisample_pipeline  7.482  1.245   5.774
find_variants                 7.455  0.180   7.540
sc_plot_genotype              5.834  0.119   5.401
MultiSampleSCPipeline         5.165  0.701   8.416
sc_DTU_analysis               4.539  0.567   4.058
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 ERROR
Running the tests in ‘tests/testthat.R’ failed.
Last 13 lines of output:
  experiment is NULL for run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
  ── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
  Expected `is.null(experiment(result))` to be FALSE.
  Differences:
  `actual`:   TRUE 
  `expected`: FALSE
  
  experiment is NULL for run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
  
  [ FAIL 12 | WARN 106 | SKIP 0 | PASS 47 ]
  Error:
  ! Test failures.
  Execution halted
  /Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown
    warnings.warn('resource_tracker: There appear to be %d '
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 5 NOTEs
See
  ‘/Users/biocbuild/bbs-3.23-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.5.1’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.1.0.2.5)’
using C++17
using SDK: ‘MacOSX11.3.1.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
  unsigned int end;
               ^
1 warning generated.
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch arm64 -std=gnu2x -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
ld: warning: ignoring duplicate libraries: '-lz'
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for ARM64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2  -Wno-unused-result" arm_neon=1 aarch64=1 minimap2)
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon main.c -o main.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon kthread.c -o kthread.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon kalloc.c -o kalloc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon misc.c -o misc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon bseq.c -o bseq.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon sketch.c -o sketch.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon sdust.c -o sdust.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon options.c -o options.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon index.c -o index.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon lchain.c -o lchain.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon align.c -o align.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon hit.c -o hit.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon seed.c -o seed.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon jump.c -o jump.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon map.c -o map.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon format.c -o format.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon pe.c -o pe.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon esterr.c -o esterr.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon splitidx.c -o splitidx.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  -Isse2neon ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__  -Isse2neon ksw2_extz2_sse.c -o ksw2_extz2_neon.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__  -Isse2neon ksw2_extd2_sse.c -o ksw2_extd2_neon.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__  -Isse2neon ksw2_exts2_sse.c -o ksw2_exts2_neon.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
cc -falign-functions=64 -Wall -g -O2  -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
echo "Installing binary to /Users/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /Users/biocbuild/bbs-3.23-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
    Updating crates.io index
  Installing oarfish v0.8.0
    Updating crates.io index
     Locking 262 packages to latest compatible versions
      Adding generic-array v0.14.7 (available: v0.14.9)
      Adding indicatif v0.17.11 (available: v0.18.3)
      Adding noodles-bam v0.78.0 (available: v0.84.0)
      Adding noodles-bgzf v0.38.0 (available: v0.44.0)
      Adding noodles-sam v0.74.0 (available: v0.80.0)
      Adding tabled v0.18.0 (available: v0.20.0)
      Adding typed-builder v0.21.2 (available: v0.23.2)
   Compiling libc v0.2.178
   Compiling proc-macro2 v1.0.103
   Compiling quote v1.0.42
   Compiling unicode-ident v1.0.22
   Compiling shlex v1.3.0
   Compiling find-msvc-tools v0.1.5
   Compiling cfg-if v1.0.4
   Compiling autocfg v1.5.0
   Compiling pkg-config v0.3.32
   Compiling libm v0.2.15
   Compiling memchr v2.7.6
   Compiling zerocopy v0.8.31
   Compiling crossbeam-utils v0.8.21
   Compiling version_check v0.9.5
   Compiling simd-adler32 v0.3.8
   Compiling adler2 v2.0.1
   Compiling once_cell v1.21.3
   Compiling crc32fast v1.5.0
   Compiling zlib-rs v0.5.4
   Compiling serde_core v1.0.228
   Compiling regex-syntax v0.8.8
   Compiling pin-project-lite v0.2.16
   Compiling getrandom v0.3.4
   Compiling typenum v1.19.0
   Compiling rawpointer v0.2.1
   Compiling futures-core v0.3.31
   Compiling miniz_oxide v0.8.9
   Compiling hashbrown v0.16.1
   Compiling either v1.15.0
   Compiling equivalent v1.0.2
   Compiling serde v1.0.228
   Compiling generic-array v0.14.7
   Compiling futures-sink v0.3.31
   Compiling lexical-util v1.0.7
   Compiling paste v1.0.15
   Compiling num-traits v0.2.19
   Compiling matrixmultiply v0.3.10
   Compiling aho-corasick v1.1.4
   Compiling indexmap v2.12.1
   Compiling futures-channel v0.3.31
   Compiling pin-utils v0.1.0
   Compiling futures-task v0.3.31
   Compiling futures-io v0.3.31
   Compiling heck v0.5.0
   Compiling slab v0.4.11
   Compiling zstd-safe v7.2.4
   Compiling vcpkg v0.2.15
   Compiling bitflags v2.10.0
   Compiling zstd-safe v6.0.6
   Compiling bytecount v0.6.9
   Compiling lexical-parse-integer v1.0.6
   Compiling lexical-write-integer v1.0.6
   Compiling num-complex v0.2.4
   Compiling ahash v0.8.12
   Compiling crossbeam-channel v0.5.15
   Compiling crossbeam-epoch v0.9.18
   Compiling tracing-core v0.1.35
   Compiling rustversion v1.0.22
   Compiling bytes v1.11.0
   Compiling regex-automata v0.4.13
   Compiling crossbeam-deque v0.8.6
   Compiling anyhow v1.0.100
   Compiling jobserver v0.1.34
   Compiling snap v1.1.1
   Compiling itoa v1.0.15
   Compiling rustix v1.1.2
   Compiling semver v1.0.27
   Compiling cc v1.2.49
   Compiling unicode-width v0.2.2
   Compiling getrandom v0.2.16
   Compiling utf8parse v0.2.2
   Compiling byteorder v1.5.0
   Compiling rayon-core v1.13.0
   Compiling lazy_static v1.5.0
   Compiling rand_core v0.6.4
   Compiling anstyle-parse v0.2.7
   Compiling rustc_version v0.4.1
   Compiling errno v0.3.14
   Compiling syn v2.0.111
   Compiling lexical-write-float v1.0.6
   Compiling proc-macro-error-attr2 v2.0.0
   Compiling lexical-parse-float v1.0.6
   Compiling buffer-redux v1.1.0
   Compiling log v0.4.29
   Compiling array-init-cursor v0.2.1
   Compiling fallible-streaming-iterator v0.1.9
   Compiling anstyle v1.0.13
   Compiling anstyle-query v1.1.5
   Compiling static_assertions v1.1.0
   Compiling bit-vec v0.8.0
   Compiling smallvec v1.15.1
   Compiling colorchoice v1.0.4
   Compiling serde_json v1.0.145
   Compiling portable-atomic v1.11.1
   Compiling ryu v1.0.20
   Compiling libz-rs-sys v0.5.4
   Compiling block-buffer v0.10.4
   Compiling crypto-common v0.1.7
   Compiling is_terminal_polyfill v1.70.2
   Compiling thiserror v1.0.69
   Compiling zstd-sys v2.0.16+zstd.1.5.7
   Compiling flate2 v1.1.5
   Compiling liblzma-sys v0.3.13
   Compiling bzip2-sys v0.1.13+1.0.8
   Compiling libz-sys v1.1.23
   Compiling sha2-asm v0.6.4
   Compiling num-integer v0.1.46
   Compiling num-complex v0.4.6
   Compiling approx v0.5.1
   Compiling minimap2-sys v0.1.24+minimap2.2.30
   Compiling num-bigint v0.4.6
   Compiling noodles-bgzf v0.38.0
   Compiling lz4-sys v1.11.1+lz4-1.10.0
   Compiling num-iter v0.1.45
   Compiling approx v0.3.2
   Compiling noisy_float v0.2.0
   Compiling ppv-lite86 v0.2.21
   Compiling digest v0.10.7
   Compiling anstream v0.6.21
   Compiling ndarray v0.16.1
   Compiling rand_chacha v0.3.1
   Compiling rand v0.8.5
   Compiling bstr v1.12.1
   Compiling matchers v0.2.0
   Compiling twox-hash v1.6.3
   Compiling streaming-decompression v0.1.2
   Compiling planus v0.3.1
   Compiling noodles-core v0.17.0
   Compiling num-rational v0.4.2
   Compiling noodles-csi v0.46.0
   Compiling proc-macro-error2 v2.0.1
   Compiling rand_distr v0.4.3
   Compiling lexical-core v1.0.6
   Compiling tracing-log v0.2.0
   Compiling bzip2 v0.4.4
   Compiling rand_core v0.9.3
   Compiling arrow2 v0.18.0
   Compiling sharded-slab v0.1.7
   Compiling cpufeatures v0.2.17
   Compiling itertools v0.13.0
   Compiling thread_local v1.1.9
   Compiling fastrand v2.3.0
   Compiling nu-ansi-term v0.50.3
   Compiling fnv v1.0.7
   Compiling clap_lex v0.7.6
   Compiling strsim v0.11.1
   Compiling seq-macro v0.3.6
   Compiling papergrid v0.14.0
   Compiling rand_chacha v0.9.0
   Compiling tempfile v3.23.0
   Compiling sha2 v0.10.9
   Compiling alga v0.9.3
   Compiling noodles-sam v0.74.0
   Compiling clap_builder v4.5.53
   Compiling num v0.4.3
   Compiling liblzma v0.3.6
   Compiling hashbrown v0.14.5
   Compiling rayon v1.11.0
   Compiling lz4_flex v0.10.0
   Compiling regex v1.12.2
   Compiling ndarray v0.15.6
   Compiling ndarray v0.17.1
   Compiling chrono v0.4.42
   Compiling console v0.15.11
   Compiling num_cpus v1.17.0
   Compiling crossbeam-queue v0.3.12
   Compiling bytemuck_derive v1.10.2
   Compiling futures-macro v0.3.31
   Compiling serde_derive v1.0.228
   Compiling async-stream-impl v0.3.6
   Compiling tracing-attributes v0.1.31
   Compiling async-trait v0.1.89
   Compiling async-stream v0.3.6
   Compiling thiserror-impl v1.0.69
   Compiling futures-util v0.3.31
   Compiling tabled_derive v0.10.0
   Compiling strum_macros v0.26.4
   Compiling clap_derive v4.5.49
   Compiling typed-builder-macro v0.21.2
   Compiling derive-new v0.6.0
   Compiling bytemuck v1.24.0
   Compiling csv-core v0.1.13
   Compiling tracing v0.1.43
   Compiling itertools v0.14.0
   Compiling number_prefix v0.4.0
   Compiling dyn-clone v1.0.20
   Compiling ethnum v1.5.2
   Compiling base64 v0.21.7
   Compiling arrayvec v0.7.6
   Compiling streaming-iterator v0.1.9
   Compiling safe_arch v0.7.4
   Compiling hex v0.4.3
   Compiling simdutf8 v0.1.5
   Compiling wide v0.7.33
   Compiling hash_hasher v2.0.4
   Compiling tracing-subscriber v0.3.22
   Compiling foreign_vec v0.1.0
   Compiling base64 v0.22.1
   Compiling num-format v0.4.4
   Compiling tabled v0.18.0
   Compiling indicatif v0.17.11
   Compiling typed-builder v0.21.2
   Compiling csv v1.4.0
   Compiling noodles-bam v0.78.0
   Compiling crossbeam v0.8.4
   Compiling rand v0.9.2
   Compiling path-tools v0.1.0
   Compiling rustc-hash v2.1.1
   Compiling atomic_float v1.1.0
   Compiling parse-size v1.1.0
   Compiling clap v4.5.53
   Compiling simba v0.9.1
   Compiling arrow-format v0.8.1
   Compiling bincode v1.3.3
   Compiling bio-types v1.0.4
   Compiling sendable-swapvec v0.4.3
   Compiling futures-executor v0.3.31
   Compiling futures v0.3.31
   Compiling parquet-format-safe v0.2.4
   Compiling lz4 v1.28.1
   Compiling ndarray-stats v0.6.0
   Compiling kders v0.1.1
   Compiling zstd v0.13.3
   Compiling zstd v0.12.4
   Compiling needletail v0.6.3
   Compiling parquet2 v0.17.2
   Compiling nalgebra v0.33.2
   Compiling minimap2 v0.1.28+minimap2.2.30
   Compiling seqcol_rs v0.4.1
   Compiling sprs v0.11.4
   Compiling statrs v0.18.0
   Compiling oarfish v0.8.0
    Finished `release` profile [optimized] target(s) in 30.65s
  Installing cargo_temp/bin/oarfish
   Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
    Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout.fail


R Under development (unstable) (2025-11-04 r88984) -- "Unsuffered Consequences"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f38f94a56/config_file_35151.json 
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f38f94a56/config_file_35151.json 
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f38f94a56/config_file_35151.json 
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894fdc019ab/config_file_35151.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2e44bcc4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f4839428/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f4839428/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f69778a3c/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f69778a3c/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f69778a3c/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f69778a3c/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f23becb53/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f35671e70/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:01:25 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f35671e70/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f35671e70/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f35671e70/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:01:26 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2822c8ff/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:01:30 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2822c8ff/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2822c8ff/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2822c8ff/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:01:40 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1cee946b/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:01:41 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1cee946b/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1cee946b/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1cee946b/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:01:41 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f19140a84/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:01:42 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f19140a84/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f19140a84/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f19140a84/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:01:51 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:01:52 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:01:52 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:01:53 2025 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Thu Dec 11 20:01:54 2025 ----------
[2m2025-12-12T01:01:54.031139Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:01:54.031462Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:01:54.031482Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:01:54.031486Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:01:54.031535Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:01:54.031542Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:01:54.033143Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-12-12T01:01:54.033331Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

[2m2025-12-12T01:01:54.033380Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-12-12T01:01:54.033389Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-12-12T01:01:54.033401Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-12-12T01:01:54.036515Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-12-12T01:01:54.052897Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:01:54.053220Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:01:54.053236Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:01:54.053242Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:01:54.053289Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:01:54.053297Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:01:54.057872Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-12-12T01:01:54.058060Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

[2m2025-12-12T01:01:54.058129Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-12-12T01:01:54.058137Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-12-12T01:01:54.058143Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-12-12T01:01:54.060559Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-12-12T01:01:54.080952Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:01:54.081239Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f675b69d8/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:01:54.081258Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:01:54.081263Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:01:54.081304Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:01:54.081311Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:01:54.086499Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-12-12T01:01:54.086727Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

[2m2025-12-12T01:01:54.086771Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-12-12T01:01:54.086784Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-12-12T01:01:54.086797Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-12-12T01:01:54.088825Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:01:54 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:02:03 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:02:03 2025 -------------------
Realignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample1_realign2transcript.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample2_realign2transcript.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Dec 11 20:02:13 2025 ----------
[2m2025-12-12T01:02:13.431619Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:02:13.431993Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:02:13.432053Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:02:13.432069Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:02:13.432143Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:02:13.432164Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:02:13.435037Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-12-12T01:02:13.435224Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

[2m2025-12-12T01:02:13.435271Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-12-12T01:02:13.435282Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-12-12T01:02:13.435290Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-12-12T01:02:13.438623Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-12-12T01:02:13.461293Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:02:13.461615Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:02:13.461642Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:02:13.461652Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:02:13.461733Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:02:13.461746Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:02:13.466043Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-12-12T01:02:13.466224Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

[2m2025-12-12T01:02:13.466345Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-12-12T01:02:13.466360Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-12-12T01:02:13.466366Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-12-12T01:02:13.469025Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-12-12T01:02:13.489116Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:02:13.489480Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f25e2746b/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:02:13.489507Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:02:13.489515Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:02:13.489577Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:02:13.489589Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:02:13.494190Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-12-12T01:02:13.494430Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

[2m2025-12-12T01:02:13.494474Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-12-12T01:02:13.494482Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-12-12T01:02:13.494488Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-12-12T01:02:13.497950Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:02:13 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:02:14 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:02:14 2025 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Thu Dec 11 20:02:15 2025 ----------
20:02:15 Thu Dec 11 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/config_file_35151.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Thu Dec 11 20:02:15 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample1_align2genome.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample2_align2genome.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample3_align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:02:25 2025 -------------
Inputs:  ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f63e3c3d5/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:02:25 2025 -------------------
Realignment complete for the following samples:
sample1 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample1_realign2transcript.bam
sample2 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample2_realign2transcript.bam
sample3 ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Dec 11 20:02:34 2025 ----------
20:02:34 Thu Dec 11 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3f91ba51/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:02:35 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3f91ba51/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:02:35 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3f91ba51/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3f91ba51/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:02:35 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f49d5fc8/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:02:35 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f49d5fc8/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:02:36 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f49d5fc8/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f49d5fc8/align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:02:45 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f364a1fb4/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:02:45 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f364a1fb4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:02:45 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f364a1fb4/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f364a1fb4/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:02:45 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f33283f10/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:02:45 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f33283f10/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:02:45 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f33283f10/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f33283f10/align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:02:55 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:02:55 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:02:55 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:02:55 2025 -------------
Inputs:  ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1d1eaa2e/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:02:55 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Thu Dec 11 20:02:56 2025 ----------
[2m2025-12-12T01:02:56.134505Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:02:56.134926Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1c423a1/realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:02:56.134950Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:02:56.134960Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:02:56.135024Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:02:56.135038Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:02:56.143309Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:02:56 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:02:56 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:03:06 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:03:06 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/realign2transcript.bam
-- Running step: transcript_quantification @ Thu Dec 11 20:03:15 2025 ----------
[2m2025-12-12T01:03:15.686335Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:03:15.686771Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f6a39260b/realign2transcript.bam, contains 10 reference sequences.
[2m2025-12-12T01:03:15.686837Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:03:15.686848Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:03:15.686914Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:03:15.686931Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-12-12T01:03:15.694343Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:03:16 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:03:16 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Thu Dec 11 20:03:16 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:03:16 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f54617ffa/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Thu Dec 11 20:03:16 2025 ----------
20:03:16 Thu Dec 11 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:03:17 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Thu Dec 11 20:03:17 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/align2genome.bam
-- Running step: isoform_identification @ Thu Dec 11 20:03:26 2025 -------------
	Counter({'counted_reads': 368, 'unmapped': 4})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:03:26 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f5847c4d7/realign2transcript.bam
-- Running step: transcript_quantification @ Thu Dec 11 20:03:35 2025 ----------
20:03:35 Thu Dec 11 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:03:36 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:03:36 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Dec 11 20:03:37 2025 ----------------
20:03:37 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample3_align2genome.bam'
	Counter({'counted_reads': 368, 'unmapped': 4})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 58.01gene_group/s]
2025-12-11 20:03:38.750 R[35151:367743010] XType: Using static font registry.
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 478648.83Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 144.05gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 367264.19Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 125.48gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 926958.98Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f879e6ce/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 96.27gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 759397.45Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:03:39 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:03:39 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:03:40 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Dec 11 20:03:49 2025 ----------------
20:03:49 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 64.78gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 552376.34Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 108.54gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1473961.20Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 148.70gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1351431.89Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f21587b36/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 80.33gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1216586.61Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:03:50 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:03:50 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:03:51 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Dec 11 20:03:52 2025 ----------------
20:03:52 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 66.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 711043.60Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 101.48gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 2687967.19Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 157.70gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1455951.12Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f3a2e4f51/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 109.24gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 587700.93Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:03:52 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:03:53 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:03:53 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Dec 11 20:04:03 2025 ----------------
20:04:03 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 63.78gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 635346.58Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 158.05gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 773058.09Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.61gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 2366988.71Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f2c091c2b/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 98.57gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1275019.46Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:04:04 2025 -------------
Unzipping annotation file for bambu
Saving _problems/test-run_FLAMES-32.R
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:04:04 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:04:05 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Dec 11 20:04:06 2025 ----------------
20:04:06 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 54.30gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 757805.88Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 138.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1978072.06Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 117.91gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1977698.98Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 79.12gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1317141.06Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:04:07 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:04:07 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Thu Dec 11 20:04:08 2025 ----------
[2m2025-12-12T01:04:08.438906Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:08.439167Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:08.440989Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:08.441011Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:08.441090Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:08.441104Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-12-12T01:04:08.450058Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2025-12-12T01:04:08.683998Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:08.685001Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:08.685057Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:08.685074Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:08.685210Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:08.685244Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-12-12T01:04:08.916005Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:08.916328Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:08.916341Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:08.916348Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:08.916391Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:08.916400Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-12-12T01:04:09.159036Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:09.159480Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f78f0c3f4/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:09.159501Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:09.159513Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:09.159584Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:09.159599Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:04:09 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:04:10 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Dec 11 20:04:20 2025 ----------------
20:04:20 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 49.32gene_group/s]
/Library/Frameworks/R.framework/Versions/4.6-arm64/Resources/library/FLAMES/python/count_gene.py:705: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 579644.00Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 150.83gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 2214521.65Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 82.67gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1656518.17Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 102.75gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 872649.80Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:04:20 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:04:20 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Dec 11 20:04:30 2025 ----------
[2m2025-12-12T01:04:30.839815Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:30.840147Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:30.840176Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:30.840182Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:30.840241Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:30.840254Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-12-12T01:04:30.848909Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2025-12-12T01:04:31.143812Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:31.144203Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:31.144264Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:31.144279Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:31.144359Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:31.144378Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-12-12T01:04:31.405956Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:31.406344Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:31.406365Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:31.406372Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:31.406422Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:31.406431Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-12-12T01:04:31.632350Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-12-12T01:04:31.632787Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f1f5eeb17/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-12-12T01:04:31.632858Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-12-12T01:04:31.632870Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-12-12T01:04:31.632956Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-12-12T01:04:31.632978Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:04:32 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:04:32 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Thu Dec 11 20:04:33 2025 ----------------
20:04:33 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 61.90gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 748501.68Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 160.23gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 2022716.05Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 75.40gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 2098831.06Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 104.03gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1131760.39Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:04:34 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:04:34 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Thu Dec 11 20:04:34 2025 ----------
20:04:34 Thu Dec 11 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f7ad416ef/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/config_file_35151.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Thu Dec 11 20:04:36 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Thu Dec 11 20:04:36 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_align2genome.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_matched_reads.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_align2genome.bam
-- Running step: gene_quantification @ Thu Dec 11 20:04:46 2025 ----------------
20:04:46 Thu Dec 11 2025 quantify genes 
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_align2genome.bam'
	Counter({'counted_reads': 176})
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 91})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 60.05gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 551882.11Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 106.65gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 434031.21Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 124.49gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 2220148.21Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 108.20gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1449911.50Read/s]
-- Running step: isoform_identification @ Thu Dec 11 20:04:46 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Thu Dec 11 20:04:46 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_realign2transcript.bam
/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_matched_reads_dedup.fastq.gz ->/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Thu Dec 11 20:04:55 2025 ----------
20:04:55 Thu Dec 11 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpfOWBo8/file894f156b92b9/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
[ FAIL 12 | WARN 106 | SKIP 0 | PASS 47 ]

══ Failed tests ════════════════════════════════════════════════════════════════
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
── Failure ('test-run_FLAMES.R:29:11'): run_FLAMES() completes and returns experiment for all pipeline types and option combinations ──
Expected `is.null(experiment(result))` to be FALSE.
Differences:
`actual`:   TRUE 
`expected`: FALSE

experiment is NULL for run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)

[ FAIL 12 | WARN 106 | SKIP 0 | PASS 47 ]
Error:
! Test failures.
Execution halted
/Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown
  warnings.warn('resource_tracker: There appear to be %d '

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

name	user	system	elapsed
BulkPipeline	2.222	0.269	2.929
MultiSampleSCPipeline	5.165	0.701	8.416
SingleCellPipeline	1.616	0.110	0.932
add_gene_counts	0.088	0.002	0.098
annotation_to_fasta	0.058	0.001	0.066
blaze	2.689	0.309	3.215
bulk_long_pipeline	1.841	0.442	1.658
combine_sce	0.224	0.044	0.292
config-set	0.099	0.104	0.211
config	0.098	0.112	0.219
controllers-set	0.154	0.034	0.198
controllers	0.116	0.107	0.235
convolution_filter	0	0	0
create_config	0.004	0.000	0.008
create_sce_from_dir	2.693	0.479	2.265
create_se_from_dir	1.229	0.327	1.613
cutadapt	0.051	0.019	0.074
example_pipeline	0.103	0.016	0.129
experiment	1.093	0.207	1.357
filter_annotation	0.016	0.002	0.017
filter_coverage	0.479	0.162	0.681
find_barcode	0.164	0.024	0.224
find_bin	0.002	0.004	0.009
find_variants	7.455	0.180	7.540
get_coverage	0.493	0.168	0.687
index_genome	0.101	0.077	0.194
mutation_positions	0.705	0.008	0.724
plot_coverage	1.080	0.142	1.258
plot_demultiplex	1.073	0.199	1.399
plot_demultiplex_raw	0.591	0.032	0.650
plot_durations	1.214	0.236	1.503
plot_isoform_heatmap	2.657	0.109	2.895
plot_isoform_reduced_dim	10.225	0.106	10.916
plot_isoforms	1.160	0.007	1.310
resume_FLAMES	1.382	0.283	1.771
run_FLAMES	1.339	0.275	1.682
run_step	0.669	0.123	0.848
sc_DTU_analysis	4.539	0.567	4.058
sc_gene_entropy	0.873	0.103	1.027
sc_genotype	1.647	0.358	1.678
sc_impute_transcript	0.194	0.003	0.209
sc_long_multisample_pipeline	7.482	1.245	5.774
sc_long_pipeline	2.436	0.321	1.662
sc_mutations	1.558	0.257	1.428
sc_plot_genotype	5.834	0.119	5.401
show-FLAMESPipeline	0.107	0.020	0.140
steps-set	0.155	0.024	0.198
steps	0.067	0.022	0.105
weight_transcripts	0.009	0.007	0.016