Back to Multiple platform build/check report for BioC 3.21:   simplified   long
ABCDEFGHIJKLMNOPQ[R]STUVWXYZ

This page was generated on 2025-09-25 11:38 -0400 (Thu, 25 Sep 2025).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo1Linux (Ubuntu 24.04.3 LTS)x86_644.5.1 (2025-06-13) -- "Great Square Root" 4827
merida1macOS 12.7.5 Montereyx86_644.5.1 RC (2025-06-05 r88288) -- "Great Square Root" 4608
kjohnson1macOS 13.6.6 Venturaarm644.5.1 Patched (2025-06-14 r88325) -- "Great Square Root" 4549
kunpeng2Linux (openEuler 24.03 LTS)aarch64R Under development (unstable) (2025-02-19 r87757) -- "Unsuffered Consequences" 4581
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 1760/2341HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
rfaRm 1.20.0  (landing page)
Lara Selles Vidal
Snapshot Date: 2025-09-22 13:40 -0400 (Mon, 22 Sep 2025)
git_url: https://git.bioconductor.org/packages/rfaRm
git_branch: RELEASE_3_21
git_last_commit: c82a20c
git_last_commit_date: 2025-04-15 11:57:31 -0400 (Tue, 15 Apr 2025)
nebbiolo1Linux (Ubuntu 24.04.3 LTS) / x86_64  OK    OK    ERROR  
merida1macOS 12.7.5 Monterey / x86_64  OK    OK    OK    OK  UNNEEDED, same version is already published
kjohnson1macOS 13.6.6 Ventura / arm64  OK    OK    OK    OK  UNNEEDED, same version is already published
kunpeng2Linux (openEuler 24.03 LTS) / aarch64  OK    OK    OK  


CHECK results for rfaRm on nebbiolo1

To the developers/maintainers of the rfaRm package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/rfaRm.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: rfaRm
Version: 1.20.0
Command: /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings rfaRm_1.20.0.tar.gz
StartedAt: 2025-09-25 03:09:28 -0400 (Thu, 25 Sep 2025)
EndedAt: 2025-09-25 03:12:37 -0400 (Thu, 25 Sep 2025)
EllapsedTime: 189.4 seconds
RetCode: 1
Status:   ERROR  
CheckDir: rfaRm.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings rfaRm_1.20.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/rfaRm.Rcheck’
* using R version 4.5.1 (2025-06-13)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
* running under: Ubuntu 24.04.3 LTS
* using session charset: UTF-8
* checking for file ‘rfaRm/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘rfaRm’ version ‘1.20.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘rfaRm’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for ‘as’
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘rfaRm-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
No encoding supplied: defaulting to UTF-8.
No encoding supplied: defaulting to UTF-8.
Error in if (checkQueryStatus == "success") { : 
  argument is of length zero
Calls: rfamSequenceSearch
Execution halted
Examples with CPU (user + system) or elapsed time > 5s
                            user system elapsed
rfamSecondaryStructurePlot 6.731  0.114   7.193
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 ERROR
Running the tests in ‘tests/runTests.R’ failed.
Last 13 lines of output:
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in /tmp/RtmpfskOMW/RLIBS_2d73c7691d5868/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /tmp/RtmpfskOMW/RLIBS_2d73c7691d5868/rfaRm/unitTests/test_searchFunctions.R : Error in if (checkQueryStatus == "success") { : 
    argument is of length zero
  
  Test files with failing tests
  
     test_searchFunctions.R 
       /tmp/RtmpfskOMW/RLIBS_2d73c7691d5868/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... ERROR
Error(s) in re-building vignettes:
--- re-building ‘rfaRm.Rmd’ using rmarkdown
Warning in eng_r(options) :
  Failed to tidy R code in chunk 'unnamed-chunk-2'. Reason:
Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored.

Warning in eng_r(options) :
  Failed to tidy R code in chunk 'unnamed-chunk-3'. Reason:
Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored.


Quitting from rfaRm.Rmd:73-83 [unnamed-chunk-3]
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
<error/rlang_error>
Error in `if (checkQueryStatus == "success") ...`:
! argument is of length zero
---
Backtrace:
    ▆
 1. └─rfaRm::rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Error: processing vignette 'rfaRm.Rmd' failed with diagnostics:
argument is of length zero
--- failed re-building ‘rfaRm.Rmd’

SUMMARY: processing the following file failed:
  ‘rfaRm.Rmd’

Error: Vignette re-building failed.
Execution halted

* checking PDF version of manual ... OK
* DONE

Status: 3 ERRORs, 1 NOTE
See
  ‘/home/biocbuild/bbs-3.21-bioc/meat/rfaRm.Rcheck/00check.log’
for details.


Installation output

rfaRm.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD INSTALL rfaRm
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.21-bioc/R/site-library’
* installing *source* package ‘rfaRm’ ...
** this is package ‘rfaRm’ version ‘1.20.0’
** using staged installation
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (rfaRm)

Tests output

rfaRm.Rcheck/tests/runTests.Rout.fail


R version 4.5.1 (2025-06-13) -- "Great Square Root"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> BiocGenerics:::testPackage("rfaRm")
Linking to librsvg 2.58.0
No encoding supplied: defaulting to UTF-8.
  format width height colorspace matte filesize density
1    SVG   700    550       sRGB  TRUE    21504   72x72
  format width height colorspace matte filesize density
1    GIF   600   2084       sRGB FALSE    63951   72x72
Running sequence search query. This might take a long time.
No encoding supplied: defaulting to UTF-8.
No encoding supplied: defaulting to UTF-8.
Error in if (checkQueryStatus == "success") { : 
  argument is of length zero


RUNIT TEST PROTOCOL -- Thu Sep 25 03:12:16 2025 
*********************************************** 
Number of test functions: 1 
Number of errors: 1 
Number of failures: 0 

 
1 Test Suite : 
rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
ERROR in /tmp/RtmpfskOMW/RLIBS_2d73c7691d5868/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /tmp/RtmpfskOMW/RLIBS_2d73c7691d5868/rfaRm/unitTests/test_searchFunctions.R : Error in if (checkQueryStatus == "success") { : 
  argument is of length zero

Test files with failing tests

   test_searchFunctions.R 
     /tmp/RtmpfskOMW/RLIBS_2d73c7691d5868/rfaRm/unitTests/test_searchFunctions.R 


Error in BiocGenerics:::testPackage("rfaRm") : 
  unit tests failed for package rfaRm
Execution halted

Example timings

rfaRm.Rcheck/rfaRm-Ex.timings

nameusersystemelapsed
rfamConsensusSecondaryStructure0.4320.0353.101
rfamCovarianceModel0.1640.0080.904
rfamFamilyAccessionToID0.0220.0010.111
rfamFamilyIDToAccession0.0110.0020.100
rfamFamilySummary0.1280.0140.663
rfamPDBMapping0.1320.0140.517
rfamSecondaryStructurePlot6.7310.1147.193
rfamSecondaryStructureXMLSVG0.0480.0040.468
rfamSeedAlignment0.4290.0501.671
rfamSeedTree0.1560.0050.554
rfamSeedTreeImage0.1570.0160.628
rfamSequenceRegions0.2280.0192.679