Back to Multiple platform build/check report for BioC 3.22:   simplified   long
ABCDEFG[H]IJKLMNOPQRSTUVWXYZ

This page was generated on 2026-01-01 11:58 -0500 (Thu, 01 Jan 2026).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo2Linux (Ubuntu 24.04.3 LTS)x86_644.5.2 (2025-10-31) -- "[Not] Part in a Rumble" 4883
taishanLinux (openEuler 24.03 LTS)aarch644.5.0 (2025-04-11) -- "How About a Twenty-Six" 4671
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 996/2361HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
hiReadsProcessor 1.46.0  (landing page)
Nirav V Malani
Snapshot Date: 2025-12-29 13:45 -0500 (Mon, 29 Dec 2025)
git_url: https://git.bioconductor.org/packages/hiReadsProcessor
git_branch: RELEASE_3_22
git_last_commit: 8ccca6d
git_last_commit_date: 2025-10-29 10:21:04 -0500 (Wed, 29 Oct 2025)
nebbiolo2Linux (Ubuntu 24.04.3 LTS) / x86_64  OK    OK    ERROR  
taishanLinux (openEuler 24.03 LTS) / aarch64  OK    OK    ERROR  


CHECK results for hiReadsProcessor on nebbiolo2

To the developers/maintainers of the hiReadsProcessor package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/hiReadsProcessor.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: hiReadsProcessor
Version: 1.46.0
Command: /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:hiReadsProcessor.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings hiReadsProcessor_1.46.0.tar.gz
StartedAt: 2025-12-30 00:25:57 -0500 (Tue, 30 Dec 2025)
EndedAt: 2025-12-30 00:30:54 -0500 (Tue, 30 Dec 2025)
EllapsedTime: 297.5 seconds
RetCode: 1
Status:   ERROR  
CheckDir: hiReadsProcessor.Rcheck
Warnings: NA

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:hiReadsProcessor.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings hiReadsProcessor_1.46.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.22-bioc/meat/hiReadsProcessor.Rcheck’
* using R version 4.5.2 (2025-10-31)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
* running under: Ubuntu 24.04.3 LTS
* using session charset: UTF-8
* checking for file ‘hiReadsProcessor/DESCRIPTION’ ... OK
* this is package ‘hiReadsProcessor’ version ‘1.46.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘hiReadsProcessor’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
chunkize: no visible global function definition for ‘breakInChunks’
chunkize: no visible global function definition for ‘detectCores’
clusterSites : <anonymous>: no visible binding for global variable
  ‘queryHits’
clusterSites: no visible binding for global variable ‘clusteredValue’
clusterSites: no visible binding for global variable
  ‘clusteredValue.freq’
crossOverCheck: no visible binding for global variable ‘queryHits’
decodeByBarcode: no visible global function definition for ‘metadata<-’
decodeByBarcode: no visible global function definition for ‘metadata’
extractSeqs : <anonymous>: no visible global function definition for
  ‘metadata’
extractSeqs : <anonymous> : <anonymous> : <anonymous>: no visible
  global function definition for ‘IRanges’
extractSeqs : <anonymous> : <anonymous>: no visible global function
  definition for ‘IRanges’
findBarcodes: no visible global function definition for ‘metadata<-’
findBarcodes: no visible global function definition for ‘metadata’
findIntegrations: no visible global function definition for
  ‘fasta.info’
findIntegrations : <anonymous>: no visible global function definition
  for ‘IRanges’
findVector : <anonymous>: no visible global function definition for
  ‘IRanges’
pairUpAlignments : <anonymous>: no visible binding for global variable
  ‘queryHits’
pairwiseAlignSeqs: no visible global function definition for
  ‘IRangesList’
pairwiseAlignSeqs: no visible global function definition for ‘IRanges’
primerIDAlignSeqs: no visible global function definition for ‘IRanges’
primerIDAlignSeqs: no visible global function definition for
  ‘IRangesList’
pslToRangedObject: no visible global function definition for ‘IRanges’
read.BAMasPSL: no visible global function definition for ‘ScanBamParam’
read.BAMasPSL: no visible global function definition for ‘scanBamFlag’
read.BAMasPSL: no visible global function definition for ‘DataFrame’
read.SeqFolder: no visible global function definition for ‘SimpleList’
read.psl: no visible global function definition for ‘mclapply’
read.psl : <anonymous>: no visible binding for global variable
  ‘matches’
read.psl : <anonymous>: no visible binding for global variable
  ‘misMatches’
read.psl : <anonymous>: no visible binding for global variable
  ‘qBaseInsert’
read.psl : <anonymous>: no visible binding for global variable
  ‘tBaseInsert’
read.psl: no visible binding for global variable ‘matches’
read.psl: no visible binding for global variable ‘misMatches’
read.psl: no visible binding for global variable ‘qBaseInsert’
read.psl: no visible binding for global variable ‘tBaseInsert’
read.sampleInfo: no visible global function definition for ‘SimpleList’
splitSeqsToFiles: no visible global function definition for
  ‘fasta.info’
vpairwiseAlignSeqs: no visible global function definition for ‘Rle’
vpairwiseAlignSeqs: no visible global function definition for
  ‘runLength’
vpairwiseAlignSeqs: no visible global function definition for ‘IRanges’
vpairwiseAlignSeqs: no visible global function definition for
  ‘runValue’
Undefined global functions or variables:
  DataFrame IRanges IRangesList Rle ScanBamParam SimpleList
  breakInChunks clusteredValue clusteredValue.freq detectCores
  fasta.info matches mclapply metadata metadata<- misMatches
  qBaseInsert queryHits runLength runValue scanBamFlag tBaseInsert
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
  annotateSites.Rd: SerialParam, doAnnotation
  blatSeqs.Rd: BiocParallel, SerialParam
  clusterSites.Rd: BiocParallel, SerialParam
  doRCtest.Rd: vcountPattern, BiocParallel, SerialParam
  findAndRemoveVector.Rd: BiocParallel, SerialParam, MulticoreParam,
    SnowParam
  findAndTrimSeq.Rd: vmatchPattern, pairwiseAlignment, MulticoreParam,
    SnowParam
  findIntegrations.Rd: BiocParallel, SerialParam, MulticoreParam,
    SnowParam
  findLTRs.Rd: BiocParallel, SerialParam, pairwiseAlignment,
    MulticoreParam, SnowParam
  findLinkers.Rd: BiocParallel, SerialParam, pairwiseAlignment,
    MulticoreParam, SnowParam
  findPrimers.Rd: vmatchPattern, pairwiseAlignment, SerialParam,
    MulticoreParam, SnowParam
  findVector.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam
  getSonicAbund.Rd: sonicLength, BiocParallel, SerialParam
  isuSites.Rd: BiocParallel, SerialParam
  otuSites.Rd: BiocParallel, SerialParam
  pairUpAlignments.Rd: BiocParallel, SerialParam
  pairwiseAlignSeqs.Rd: pairwiseAlignment, BiocParallel, SerialParam,
    MulticoreParam, SnowParam
  primerIDAlignSeqs.Rd: pairwiseAlignment
  read.blast8.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam
  read.psl.Rd: BiocParallel, SerialParam, MulticoreParam, SnowParam
  troubleshootLinkers.Rd: BiocParallel, SerialParam, pairwiseAlignment,
    MulticoreParam, SnowParam
  vpairwiseAlignSeqs.Rd: vmatchPattern, BiocParallel, SerialParam,
    MulticoreParam, SnowParam
  write.listedDNAStringSet.Rd: BiocParallel, SerialParam,
    writeXStringSet, MulticoreParam, SnowParam
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘hiReadsProcessor-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: findAndTrimSeq
> ### Title: Find and trim a short pattern sequence from the subject.
> ### Aliases: findAndTrimSeq
> 
> ### ** Examples
> 
> findAndTrimSeq(patternSeq="AGACCCTTTT",
+ subjectSeqs=DNAStringSet(c("AGACCCTTTTGAGCAGCAT","AGACCCTTGGTCGACTCA",
+ "AGACCCTTTTGACGAGCTAG")), qualityThreshold=.85, doRC=FALSE, side="left", 
+ offBy=1, alignWay = "slow")
Error in (function (cond)  : 
  error in evaluating the argument 'x' in selecting a method for function 'start': pattern() has moved from Biostrings to the pwalign package, and is formally
  defunct in Biostrings >= 2.77.1. Please call pwalign::pattern() to get rid of
  this error.
Calls: findAndTrimSeq ... start -> pattern -> .call_fun_in_pwalign -> .Defunct
Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 3 NOTEs
See
  ‘/home/biocbuild/bbs-3.22-bioc/meat/hiReadsProcessor.Rcheck/00check.log’
for details.


Installation output

hiReadsProcessor.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD INSTALL hiReadsProcessor
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.22-bioc/R/site-library’
* installing *source* package ‘hiReadsProcessor’ ...
** this is package ‘hiReadsProcessor’ version ‘1.46.0’
** using staged installation
** R
** data
** inst
** byte-compile and prepare package for lazy loading
Warning message:
In fun(libname, pkgname) :
  Package 'hiAnnotator' is deprecated and will be removed from
  Bioconductor version 3.23
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded from temporary location
Warning in fun(libname, pkgname) :
  Package 'hiAnnotator' is deprecated and will be removed from
  Bioconductor version 3.23
Warning in fun(libname, pkgname) :
  Package 'hiReadsProcessor' is deprecated and will be removed from
  Bioconductor version 3.23
** testing if installed package can be loaded from final location
Warning in fun(libname, pkgname) :
  Package 'hiAnnotator' is deprecated and will be removed from
  Bioconductor version 3.23
Warning in fun(libname, pkgname) :
  Package 'hiReadsProcessor' is deprecated and will be removed from
  Bioconductor version 3.23
** testing if installed package keeps a record of temporary installation path
* DONE (hiReadsProcessor)

Tests output


Example timings

hiReadsProcessor.Rcheck/hiReadsProcessor-Ex.timings

nameusersystemelapsed
addFeature0.2120.0100.222
addListNameToReads0.2630.0030.266
annotateSites000
blatSeqs000
chunkize0.0310.0000.031
clusterSites0.310.000.31
crossOverCheck0.0960.0020.098
dereplicateReads0.0410.0020.043
doRCtest3.7450.0653.826
extractFeature0.1370.0940.129
extractSeqs0.3560.0230.379