Back to Multiple platform build/check report for BioC 3.21: simplified long |
|
This page was generated on 2025-10-16 11:40 -0400 (Thu, 16 Oct 2025).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.5.1 (2025-06-13) -- "Great Square Root" | 4833 |
merida1 | macOS 12.7.6 Monterey | x86_64 | 4.5.1 RC (2025-06-05 r88288) -- "Great Square Root" | 4614 |
kjohnson1 | macOS 13.7.5 Ventura | arm64 | 4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root" | 4555 |
kunpeng2 | Linux (openEuler 24.03 LTS) | aarch64 | R Under development (unstable) (2025-02-19 r87757) -- "Unsuffered Consequences" | 4586 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 735/2341 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 2.2.0 (landing page) Changqing Wang
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | OK | ![]() | ||||||||
merida1 | macOS 12.7.6 Monterey / x86_64 | OK | OK | OK | OK | ![]() | ||||||||
kjohnson1 | macOS 13.7.5 Ventura / arm64 | OK | OK | OK | OK | ![]() | ||||||||
kunpeng2 | Linux (openEuler 24.03 LTS) / aarch64 | OK | OK | ERROR | ||||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 2.2.0 |
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz |
StartedAt: 2025-10-14 21:41:55 -0400 (Tue, 14 Oct 2025) |
EndedAt: 2025-10-14 21:53:26 -0400 (Tue, 14 Oct 2025) |
EllapsedTime: 691.3 seconds |
RetCode: 0 |
Status: OK |
CheckDir: FLAMES.Rcheck |
Warnings: 0 |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’ * using R version 4.5.1 Patched (2025-06-14 r88325) * using platform: aarch64-apple-darwin20 * R was compiled by Apple clang version 16.0.0 (clang-1600.0.26.6) GNU Fortran (GCC) 14.2.0 * running under: macOS Ventura 13.7.5 * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * this is package ‘FLAMES’ version ‘2.2.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... INFO Imports includes 46 non-default packages. Importing from so many packages makes the package vulnerable to any of them becoming unavailable. Move as many as possible to Suggests and use conditionally. * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’ * used SDK: ‘MacOSX11.3.sdk’ * checking C++ specification ... OK * checking installed package size ... INFO installed size is 5.4Mb sub-directories of 1Mb or more: data 2.7Mb libs 1.6Mb * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE addRowRanges: no visible global function definition for ‘head’ chisq_test_by_gene: no visible global function definition for ‘chisq.test’ create_spe: no visible binding for global variable ‘barcode’ create_spe: no visible binding for global variable ‘in_tissue’ filter_coverage: no visible global function definition for ‘starts_with’ filter_coverage: no visible binding for global variable ‘filter_res’ find_barcode: no visible binding for global variable ‘Sample’ find_barcode: no visible binding for global variable ‘Outfile’ find_variants_grange: no visible binding for global variable ‘which_label’ find_variants_grange: no visible binding for global variable ‘nucleotide’ find_variants_grange: no visible binding for global variable ‘pos’ find_variants_grange: no visible binding for global variable ‘count’ find_variants_grange: no visible binding for global variable ‘counts_no_ins’ find_variants_grange: no visible binding for global variable ‘ref’ generate_sc_sce: no visible binding for global variable ‘FSM_match’ get_coverage: no visible binding for global variable ‘Freq’ homopolymer_pct : <anonymous>: no visible binding for global variable ‘Freq’ homopolymer_pct : <anonymous>: no visible binding for global variable ‘pct’ plot_coverage: no visible binding for global variable ‘tr_length’ plot_coverage: no visible binding for global variable ‘read_counts’ plot_coverage: no visible binding for global variable ‘total_counts’ plot_coverage: no visible binding for global variable ‘cumpct’ plot_coverage: no visible binding for global variable ‘length_bin’ plot_coverage: no visible binding for global variable ‘min_length’ plot_coverage: no visible binding for global variable ‘max_length’ plot_coverage: no visible global function definition for ‘head’ plot_coverage: no visible binding for global variable ‘transcript’ plot_demultiplex: no visible binding for global variable ‘CellBarcode’ plot_demultiplex: no visible binding for global variable ‘Sample’ plot_demultiplex: no visible binding for global variable ‘UMI’ plot_demultiplex: no visible binding for global variable ‘UMI_count’ plot_demultiplex: no visible binding for global variable ‘barcode_rank’ plot_demultiplex: no visible binding for global variable ‘FlankEditDist’ plot_demultiplex: no visible binding for global variable ‘n_reads’ plot_demultiplex: no visible binding for global variable ‘BarcodeEditDist’ plot_demultiplex: no visible binding for global variable ‘total reads’ plot_demultiplex: no visible binding for global variable ‘demultiplexed reads’ plot_demultiplex: no visible binding for global variable ‘single match reads’ plot_demultiplex: no visible binding for global variable ‘undemultiplexted reads’ plot_demultiplex: no visible binding for global variable ‘multi-matching reads’ plot_demultiplex: no visible binding for global variable ‘Type’ plot_demultiplex: no visible binding for global variable ‘Reads’ plot_demultiplex: no visible binding for global variable ‘input’ plot_demultiplex: no visible binding for global variable ‘output’ plot_demultiplex: no visible binding for global variable ‘read1_with_adapter’ plot_demultiplex: no visible binding for global variable ‘Count’ plot_flagstat: no visible global function definition for ‘everything’ plot_flagstat: no visible binding for global variable ‘name’ plot_flagstat: no visible binding for global variable ‘value’ plot_isoform_reduced_dim: no visible binding for global variable ‘x’ plot_isoform_reduced_dim: no visible binding for global variable ‘y’ plot_isoform_reduced_dim: no visible binding for global variable ‘expr’ plot_spatial: no visible binding for global variable ‘imageX’ plot_spatial: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘imageX’ plot_spatial_feature: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘x’ plot_spatial_feature: no visible binding for global variable ‘y’ plot_spatial_feature: no visible global function definition for ‘scale_alpha_continuous’ plot_spatial_feature: no visible global function definition for ‘scale_colour_gradient’ plot_spatial_isoform: no visible global function definition for ‘head’ plot_spatial_pie: no visible global function definition for ‘head’ plot_spatial_pie: no visible binding for global variable ‘imageX’ plot_spatial_pie: no visible binding for global variable ‘imageY’ sc_mutations: no visible binding for global variable ‘mutation_index’ sc_mutations: no visible binding for global variable ‘bam_index’ sc_transcript_usage_chisq: no visible binding for global variable ‘p.value’ sc_transcript_usage_chisq: no visible binding for global variable ‘adj.p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘total’ sc_transcript_usage_permutation: no visible binding for global variable ‘test’ sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible global function definition for ‘na.omit’ sc_transcript_usage_permutation: no visible binding for global variable ‘transcript’ sc_transcript_usage_permutation: no visible binding for global variable ‘p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘adj.p.value’ variant_count_tb: no visible binding for global variable ‘barcode’ variant_count_tb: no visible binding for global variable ‘allele_count’ variant_count_tb: no visible binding for global variable ‘cell_total_reads’ Undefined global functions or variables: BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count bam_index barcode barcode_rank cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed reads everything expr filter_res head imageX imageY in_tissue input length_bin max_length min_length multi-matching reads mutation_index n_reads na.omit name nucleotide output p.value pct pos read1_with_adapter read_counts ref scale_alpha_continuous scale_colour_gradient single match reads starts_with test total total reads total_counts tr_length transcript undemultiplexted reads value which_label x y Consider adding importFrom("base", "match", "single") importFrom("stats", "chisq.test", "na.omit") importFrom("utils", "head") to your NAMESPACE file. * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... NOTE Found the following Rd file(s) with Rd \link{} targets missing package anchors: bulk_long_pipeline.Rd: SummarizedExperiment sc_long_multisample_pipeline.Rd: SingleCellExperiment sc_long_pipeline.Rd: SingleCellExperiment Please provide package anchors for all Rd \link{} targets not in the package itself and the base packages. * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... INFO GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs/FLAMES.so’: Found ‘___assert_rtn’, possibly from ‘assert’ (C) Found ‘___stderrp’, possibly from ‘stderr’ (C) Found ‘___stdoutp’, possibly from ‘stdout’ (C) Found ‘_abort’, possibly from ‘abort’ (C) Found ‘_exit’, possibly from ‘exit’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed bulk_long_pipeline 31.691 2.560 33.981 plot_isoform_reduced_dim 28.467 0.322 28.919 create_se_from_dir 26.254 0.818 24.210 sc_long_multisample_pipeline 22.107 3.099 20.852 sc_DTU_analysis 11.954 1.686 11.980 get_GRangesList 9.852 0.269 10.250 create_sce_from_dir 8.106 1.959 11.512 plot_isoform_heatmap 9.615 0.307 9.953 find_isoform 9.624 0.242 10.232 plot_coverage 8.451 0.266 8.842 minimap2_align 8.188 0.238 8.735 sc_long_pipeline 6.519 1.071 5.695 filter_coverage 5.611 0.273 6.643 get_coverage 5.626 0.225 5.924 find_variants 4.621 0.408 5.251 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 4 NOTEs See ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** this is package ‘FLAMES’ version ‘2.2.0’ ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’ using C++17 using SDK: ‘MacOSX11.3.sdk’ clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable] unsigned int end; ^ 1 warning generated. clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang -arch arm64 -std=gnu2x -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R ld: warning: ignoring duplicate libraries: '-lz' if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices *** copying figures ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: aarch64-apple-darwin20 R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > # This file is part of the standard setup for testthat. > # It is recommended that you do not modify it. > # > # Where should you do additional test configuration? > # Learn more about the roles of various files in: > # * https://r-pkgs.org/tests.html > # * https://testthat.r-lib.org/reference/test_package.html#special-files > > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/RtmpiymqvG/file1595e5d9fedc0/config_file_88414.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595e4a5acd2c/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595eada8eb8/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595eada8eb8/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_1.fastq Searching for barcodes... Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_2.fastq Searching for barcodes... Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_3.fastq Searching for barcodes... Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_4.fastq Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595e33f59605/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595e33f59605/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_1.fastq Searching for barcodes... Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_2.fastq Searching for barcodes... Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_3.fastq Searching for barcodes... Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_4.fastq Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595e33f59605/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpiymqvG/file1595e6becaaab/bc_allow.tsv Number of known barcodes: 143 Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... [ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ] > > proc.time() user system elapsed 24.080 1.361 28.382
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
add_gene_counts | 0.517 | 0.007 | 0.538 | |
annotation_to_fasta | 1.540 | 0.030 | 1.593 | |
blaze | 0.322 | 0.056 | 1.987 | |
bulk_long_pipeline | 31.691 | 2.560 | 33.981 | |
combine_sce | 0.716 | 0.012 | 0.734 | |
convolution_filter | 0.000 | 0.000 | 0.001 | |
create_config | 0.005 | 0.001 | 0.008 | |
create_sce_from_dir | 8.106 | 1.959 | 11.512 | |
create_se_from_dir | 26.254 | 0.818 | 24.210 | |
cutadapt | 0.114 | 0.046 | 0.169 | |
filter_annotation | 0.544 | 0.083 | 0.690 | |
filter_coverage | 5.611 | 0.273 | 6.643 | |
find_barcode | 1.116 | 0.276 | 1.545 | |
find_bin | 0.011 | 0.014 | 0.037 | |
find_isoform | 9.624 | 0.242 | 10.232 | |
find_variants | 4.621 | 0.408 | 5.251 | |
get_GRangesList | 9.852 | 0.269 | 10.250 | |
get_coverage | 5.626 | 0.225 | 5.924 | |
minimap2_align | 8.188 | 0.238 | 8.735 | |
minimap2_realign | 0.810 | 0.103 | 0.935 | |
mutation_positions | 1.956 | 0.025 | 2.000 | |
plot_coverage | 8.451 | 0.266 | 8.842 | |
plot_demultiplex | 1.973 | 0.130 | 2.132 | |
plot_isoform_heatmap | 9.615 | 0.307 | 9.953 | |
plot_isoform_reduced_dim | 28.467 | 0.322 | 28.919 | |
plot_isoforms | 3.434 | 0.015 | 3.459 | |
quantify_transcript | 2.363 | 0.085 | 2.483 | |
quantify_transcript_flames | 1.913 | 0.076 | 2.039 | |
sc_DTU_analysis | 11.954 | 1.686 | 11.980 | |
sc_impute_transcript | 0.573 | 0.009 | 0.582 | |
sc_long_multisample_pipeline | 22.107 | 3.099 | 20.852 | |
sc_long_pipeline | 6.519 | 1.071 | 5.695 | |
sc_mutations | 2.451 | 0.447 | 3.089 | |
weight_transcripts | 0.025 | 0.022 | 0.051 | |