| Back to Multiple platform build/check report for BioC 3.23: simplified long |
|
This page was generated on 2026-03-31 11:33 -0400 (Tue, 31 Mar 2026).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.6.0 alpha (2026-03-30 r89742) | 4606 |
| kjohnson3 | macOS 13.7.7 Ventura | arm64 | 4.6.0 alpha (2026-03-28 r89739) | 4534 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 24/2374 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| affxparser 1.83.0 (landing page) Kasper Daniel Hansen
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | WARNINGS | |||||||||
| kjohnson3 | macOS 13.7.7 Ventura / arm64 | OK | OK | WARNINGS | ERROR | |||||||||
| See other builds for affxparser in R Universe. | ||||||||||||||
|
To the developers/maintainers of the affxparser package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/affxparser.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: affxparser |
| Version: 1.83.0 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:affxparser.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings affxparser_1.83.0.tar.gz |
| StartedAt: 2026-03-30 18:13:55 -0400 (Mon, 30 Mar 2026) |
| EndedAt: 2026-03-30 18:14:21 -0400 (Mon, 30 Mar 2026) |
| EllapsedTime: 26.3 seconds |
| RetCode: 0 |
| Status: WARNINGS |
| CheckDir: affxparser.Rcheck |
| Warnings: 2 |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:affxparser.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings affxparser_1.83.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.23-bioc/meat/affxparser.Rcheck’
* using R version 4.6.0 alpha (2026-03-28 r89739)
* using platform: aarch64-apple-darwin23
* R was compiled by
Apple clang version 17.0.0 (clang-1700.3.19.1)
GNU Fortran (GCC) 14.2.0
* running under: macOS Tahoe 26.3.1
* using session charset: UTF-8
* current time: 2026-03-30 22:13:55 UTC
* using option ‘--no-vignettes’
* checking for file ‘affxparser/DESCRIPTION’ ... OK
* this is package ‘affxparser’ version ‘1.83.0’
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘affxparser’ can be installed ... WARNING
Found the following significant warnings:
fusion/calvin_files/utils/src/AffymetrixGuid.cpp:106:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
fusion/util/AffxConv.cpp:122:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
fusion/util/AffxConv.cpp:124:8: warning: self-comparison always evaluates to false [-Wtautological-compare]
fusion/util/AffxConv.cpp:178:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
fusion/util/AffxConv.cpp:200:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
fusion/util/AffxConv.cpp:224:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
See ‘/Users/biocbuild/bbs-3.23-bioc/meat/affxparser.Rcheck/00install.out’ for details.
* used C compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
* used C++ compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
* used SDK: ‘MacOSX26.2.sdk’
* checking installed package size ... OK
* checking package directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... OK
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... WARNING
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.6/Resources/library/affxparser/libs/affxparser.so’:
Found ‘__ZNSt3__14cerrE’, possibly from ‘std::cerr’ (C++)
Found ‘__ZNSt3__14coutE’, possibly from ‘std::cout’ (C++)
Found ‘___stdoutp’, possibly from ‘stdout’ (C)
Found ‘_exit’, possibly from ‘exit’ (C)
Found ‘_printf’, possibly from ‘printf’ (C)
Found ‘_rand’, possibly from ‘rand’ (C)
Found ‘_sprintf’, possibly from ‘sprintf’ (C)
Found ‘_srand’, possibly from ‘srand’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking examples ... OK
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘convertCel.R’
Running ‘readCdfDataFrame.R’
Running ‘readCdfQc.R’
Running ‘readCdfUnitsWriteMap.R’
Running ‘readCdfUnits_etal.R’
Running ‘readCel.R’
Running ‘readCelIntensities.R’
Running ‘readCelRectangle.R’
Running ‘readCelUnits.R’
Running ‘readPgf.R’
Running ‘testWriteAndReadEmptyCdf.R’
Running ‘testWriteAndReadEmptyCel.R’
OK
* checking PDF version of manual ... OK
* DONE
Status: 2 WARNINGs
See
‘/Users/biocbuild/bbs-3.23-bioc/meat/affxparser.Rcheck/00check.log’
for details.
affxparser.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL affxparser
###
##############################################################################
##############################################################################
* installing to library ‘/Library/Frameworks/R.framework/Versions/4.6/Resources/library’
* installing *source* package ‘affxparser’ ...
** this is package ‘affxparser’ version ‘1.83.0’
** using staged installation
** libs
using C compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
using C++ compiler: ‘Apple clang version 17.0.0 (clang-1700.6.4.2)’
using SDK: ‘MacOSX26.2.sdk’
rm -f fusion/calvin_files/data/src/CDFData.o fusion/calvin_files/data/src/CDFProbeGroupInformation.o fusion/calvin_files/data/src/CDFProbeInformation.o fusion/calvin_files/data/src/CDFProbeSetInformation.o fusion/calvin_files/data/src/CDFQCProbeInformation.o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o fusion/calvin_files/data/src/CELData.o fusion/calvin_files/data/src/CHPBackgroundZone.o fusion/calvin_files/data/src/CHPData.o fusion/calvin_files/data/src/CHPExpressionEntry.o fusion/calvin_files/data/src/CHPMultiDataData.o fusion/calvin_files/data/src/CHPTilingData.o fusion/calvin_files/data/src/CHPQuantificationData.o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o fusion/calvin_files/data/src/CHPGenotypeEntry.o fusion/calvin_files/data/src/CHPUniversalEntry.o fusion/calvin_files/data/src/ColumnInfo.o fusion/calvin_files/data/src/DataGroup.o fusion/calvin_files/data/src/DataGroupHeader.o fusion/calvin_files/data/src/DataSet.o fusion/calvin_files/data/src/DataSetHeader.o fusion/calvin_files/data/src/FileHeader.o fusion/calvin_files/data/src/GenericData.o fusion/calvin_files/data/src/GenericDataHeader.o fusion/calvin_files/exception/src/ExceptionBase.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionBPMAPData.o fusion/calvin_files/fusion/src/FusionCDFData.o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o fusion/calvin_files/fusion/src/FusionCELData.o fusion/calvin_files/fusion/src/FusionCHPData.o fusion/calvin_files/fusion/src/FusionProbeSetResults.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o fusion/calvin_files/fusion/src/FusionCHPTilingData.o fusion/calvin_files/fusion/src/FusionCHPGenericData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o fusion/calvin_files/parameter/src/ParameterNameValueType.o fusion/calvin_files/parsers/src/CDFFileReader.o fusion/calvin_files/parsers/src/CelFileReader.o fusion/calvin_files/parsers/src/CHPFileReader.o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o fusion/calvin_files/parsers/src/CHPTilingFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o fusion/calvin_files/parsers/src/DataGroupReader.o fusion/calvin_files/parsers/src/DataSetHeaderReader.o fusion/calvin_files/parsers/src/DataSetReader.o fusion/calvin_files/parsers/src/FileHeaderReader.o fusion/calvin_files/parsers/src/FileInput.o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o fusion/calvin_files/parsers/src/GenericFileReader.o fusion/calvin_files/utils/src/AffymetrixGuid.o fusion/calvin_files/utils/src/DateTime.o fusion/calvin_files/utils/src/FileUtils.o fusion/calvin_files/utils/src/StringUtils.o fusion/calvin_files/utils/src/checksum.o fusion/file/BPMAPFileData.o fusion/file/BPMAPFileWriter.o fusion/file/CDFFileData.o fusion/file/CELFileData.o fusion/file/CHPFileData.o fusion/file/FileIO.o fusion/file/FileWriter.o fusion/file/TsvFile/ClfFile.o fusion/file/TsvFile/PgfFile.o fusion/file/TsvFile/TsvFile.o fusion/util/AffxByteArray.o fusion/util/AffxConv.o fusion/util/MsgStream.o fusion/util/Util.o fusion/util/Err.o fusion/util/Fs.o fusion/util/Verbose.o fusion/util/RowFile.o fusion/util/TableFile.o fusion/util/Convert.o R_affx_cel_parser.o R_affx_cdf_parser.o R_affx_cdf_extras.o R_affx_bpmap_parser.o R_affx_clf_pgf_parser.o R_affx_chp_parser.o 000.init.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFData.cpp -o fusion/calvin_files/data/src/CDFData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeGroupInformation.cpp -o fusion/calvin_files/data/src/CDFProbeGroupInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeInformation.cpp -o fusion/calvin_files/data/src/CDFProbeInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFProbeSetInformation.cpp -o fusion/calvin_files/data/src/CDFProbeSetInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFQCProbeInformation.cpp -o fusion/calvin_files/data/src/CDFQCProbeInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CDFQCProbeSetInformation.cpp -o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CELData.cpp -o fusion/calvin_files/data/src/CELData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPBackgroundZone.cpp -o fusion/calvin_files/data/src/CHPBackgroundZone.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPData.cpp -o fusion/calvin_files/data/src/CHPData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPExpressionEntry.cpp -o fusion/calvin_files/data/src/CHPExpressionEntry.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPMultiDataData.cpp -o fusion/calvin_files/data/src/CHPMultiDataData.o
fusion/calvin_files/data/src/CHPMultiDataData.cpp:41:27: warning: unused variable 'GENOTYPE_CALL_NAME' [-Wunused-const-variable]
41 | const static std::wstring GENOTYPE_CALL_NAME = L"Call";
| ^~~~~~~~~~~~~~~~~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:56:27: warning: unused variable 'CYTO_CALL_NAME' [-Wunused-const-variable]
56 | const static std::wstring CYTO_CALL_NAME = L"Call";
| ^~~~~~~~~~~~~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:77:27: warning: unused variable 'COPY_NUMBER_VARIATION_CALL_NAME' [-Wunused-const-variable]
77 | const static std::wstring COPY_NUMBER_VARIATION_CALL_NAME = L"Call";
| ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:209:27: warning: unused variable 'CN' [-Wunused-const-variable]
209 | const static std::wstring CN = L"CN";
| ^~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:210:27: warning: unused variable 'LOH' [-Wunused-const-variable]
210 | const static std::wstring LOH = L"LOH";
| ^~~
fusion/calvin_files/data/src/CHPMultiDataData.cpp:220:27: warning: unused variable 'SCAR' [-Wunused-const-variable]
220 | const static std::wstring SCAR = L"SCAR";
| ^~~~
6 warnings generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPTilingData.cpp -o fusion/calvin_files/data/src/CHPTilingData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPQuantificationData.cpp -o fusion/calvin_files/data/src/CHPQuantificationData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPQuantificationDetectionData.cpp -o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPGenotypeEntry.cpp -o fusion/calvin_files/data/src/CHPGenotypeEntry.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/CHPUniversalEntry.cpp -o fusion/calvin_files/data/src/CHPUniversalEntry.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/ColumnInfo.cpp -o fusion/calvin_files/data/src/ColumnInfo.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataGroup.cpp -o fusion/calvin_files/data/src/DataGroup.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataGroupHeader.cpp -o fusion/calvin_files/data/src/DataGroupHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataSet.cpp -o fusion/calvin_files/data/src/DataSet.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/DataSetHeader.cpp -o fusion/calvin_files/data/src/DataSetHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/FileHeader.cpp -o fusion/calvin_files/data/src/FileHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/GenericData.cpp -o fusion/calvin_files/data/src/GenericData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/data/src/GenericDataHeader.cpp -o fusion/calvin_files/data/src/GenericDataHeader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/exception/src/ExceptionBase.cpp -o fusion/calvin_files/exception/src/ExceptionBase.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.cpp -o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.cpp -o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionBPMAPData.cpp -o fusion/calvin_files/fusion/src/FusionBPMAPData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCDFData.cpp -o fusion/calvin_files/fusion/src/FusionCDFData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.cpp -o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCELData.cpp -o fusion/calvin_files/fusion/src/FusionCELData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPData.cpp -o fusion/calvin_files/fusion/src/FusionCHPData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionProbeSetResults.cpp -o fusion/calvin_files/fusion/src/FusionProbeSetResults.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.cpp -o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.cpp -o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPLegacyData.cpp -o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.cpp -o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPMultiDataData.cpp -o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPTilingData.cpp -o fusion/calvin_files/fusion/src/FusionCHPTilingData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPGenericData.cpp -o fusion/calvin_files/fusion/src/FusionCHPGenericData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPQuantificationData.cpp -o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.cpp -o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parameter/src/ParameterNameValueType.cpp -o fusion/calvin_files/parameter/src/ParameterNameValueType.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CDFFileReader.cpp -o fusion/calvin_files/parsers/src/CDFFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CelFileReader.cpp -o fusion/calvin_files/parsers/src/CelFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPFileReader.cpp -o fusion/calvin_files/parsers/src/CHPFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPMultiDataFileReader.cpp -o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPTilingFileReader.cpp -o fusion/calvin_files/parsers/src/CHPTilingFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPQuantificationFileReader.cpp -o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.cpp -o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataGroupHeaderReader.cpp -o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataGroupReader.cpp -o fusion/calvin_files/parsers/src/DataGroupReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataSetHeaderReader.cpp -o fusion/calvin_files/parsers/src/DataSetHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/DataSetReader.cpp -o fusion/calvin_files/parsers/src/DataSetReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/FileHeaderReader.cpp -o fusion/calvin_files/parsers/src/FileHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/FileInput.cpp -o fusion/calvin_files/parsers/src/FileInput.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/GenericDataHeaderReader.cpp -o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/parsers/src/GenericFileReader.cpp -o fusion/calvin_files/parsers/src/GenericFileReader.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/AffymetrixGuid.cpp -o fusion/calvin_files/utils/src/AffymetrixGuid.o
fusion/calvin_files/utils/src/AffymetrixGuid.cpp:106:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
106 | sprintf(guid, "%10d-%10d-%10d-%10d-%10d",
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
278 | __deprecated_msg("This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
227 | #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
| ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/DateTime.cpp -o fusion/calvin_files/utils/src/DateTime.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/FileUtils.cpp -o fusion/calvin_files/utils/src/FileUtils.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/StringUtils.cpp -o fusion/calvin_files/utils/src/StringUtils.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/calvin_files/utils/src/checksum.cpp -o fusion/calvin_files/utils/src/checksum.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/BPMAPFileData.cpp -o fusion/file/BPMAPFileData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/BPMAPFileWriter.cpp -o fusion/file/BPMAPFileWriter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/CDFFileData.cpp -o fusion/file/CDFFileData.o
fusion/file/CDFFileData.cpp:1040:7: warning: unused typedef 'TilingTypes' [-Wunused-local-typedef]
1040 | } TilingTypes;
| ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/CELFileData.cpp -o fusion/file/CELFileData.o
fusion/file/CELFileData.cpp:1926:7: warning: variable 'iCell' set but not used [-Wunused-but-set-variable]
1926 | int iCell=0;
| ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/CHPFileData.cpp -o fusion/file/CHPFileData.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/FileIO.cpp -o fusion/file/FileIO.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/FileWriter.cpp -o fusion/file/FileWriter.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/TsvFile/ClfFile.cpp -o fusion/file/TsvFile/ClfFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/TsvFile/PgfFile.cpp -o fusion/file/TsvFile/PgfFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/file/TsvFile/TsvFile.cpp -o fusion/file/TsvFile/TsvFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/AffxByteArray.cpp -o fusion/util/AffxByteArray.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/AffxConv.cpp -o fusion/util/AffxConv.o
fusion/util/AffxConv.cpp:122:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
122 | sprintf(szValue, "%d", i);
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
278 | __deprecated_msg("This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
227 | #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
| ^
fusion/util/AffxConv.cpp:124:8: warning: self-comparison always evaluates to false [-Wtautological-compare]
124 | if (i != i) {return "nan";}
| ^
fusion/util/AffxConv.cpp:178:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
178 | sprintf(szValue, "%u", i);
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
278 | __deprecated_msg("This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
227 | #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
| ^
fusion/util/AffxConv.cpp:200:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
200 | sprintf(szValue, "%.16g", d);
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
278 | __deprecated_msg("This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
227 | #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
| ^
fusion/util/AffxConv.cpp:224:2: warning: 'sprintf' is deprecated: This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead. [-Wdeprecated-declarations]
224 | sprintf(szValue, "%.16g", d);
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/_stdio.h:278:1: note: 'sprintf' has been explicitly marked deprecated here
278 | __deprecated_msg("This function is provided for compatibility reasons only. Due to security concerns inherent in the design of sprintf(3), it is highly recommended that you use snprintf(3) instead.")
| ^
/Library/Developer/CommandLineTools/SDKs/MacOSX26.sdk/usr/include/sys/cdefs.h:227:48: note: expanded from macro '__deprecated_msg'
227 | #define __deprecated_msg(_msg) __attribute__((__deprecated__(_msg)))
| ^
5 warnings generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/MsgStream.cpp -o fusion/util/MsgStream.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/Util.cpp -o fusion/util/Util.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/Err.cpp -o fusion/util/Err.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/Fs.cpp -o fusion/util/Fs.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/Verbose.cpp -o fusion/util/Verbose.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/RowFile.cpp -o fusion/util/RowFile.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/TableFile.cpp -o fusion/util/TableFile.o
In file included from fusion/util/TableFile.cpp:28:
fusion/util/TableFile.h:231:8: warning: private field 'm_Comment' is not used [-Wunused-private-field]
231 | char m_Comment; ///< Comment character for data.
| ^
1 warning generated.
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c fusion/util/Convert.cpp -o fusion/util/Convert.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c R_affx_cel_parser.cpp -o R_affx_cel_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c R_affx_cdf_parser.cpp -o R_affx_cdf_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c R_affx_cdf_extras.cpp -o R_affx_cdf_extras.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c R_affx_bpmap_parser.cpp -o R_affx_bpmap_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c R_affx_clf_pgf_parser.cpp -o R_affx_clf_pgf_parser.o
clang++ -arch arm64 -std=gnu++20 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -Wno-sign-compare -O0 -c R_affx_chp_parser.cpp -o R_affx_chp_parser.o
clang -arch arm64 -std=gnu23 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -I. -Ifusion/calvin_files/array/src -Ifusion/calvin_files/data/src -Ifusion/calvin_files/exception/src -Ifusion/calvin_files/fusion/src -Ifusion/calvin_files/fusion/src/GCOSAdapter -Ifusion/calvin_files/fusion/src/CalvinAdapter -Ifusion/calvin_files/parameter/src -Ifusion/calvin_files/parsers/src -Ifusion/calvin_files/portability/src -Ifusion/calvin_files/template/src -Ifusion/calvin_files/utils/src -Ifusion/calvin_files/writers/src -Ifusion/file -Ifusion/file/TsvFile -Ifusion/portability -Ifusion/util -Ifusion -D_USE_MEM_MAPPING_ -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c 000.init.c -o 000.init.o
clang++ -arch arm64 -std=gnu++20 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o affxparser.so fusion/calvin_files/data/src/CDFData.o fusion/calvin_files/data/src/CDFProbeGroupInformation.o fusion/calvin_files/data/src/CDFProbeInformation.o fusion/calvin_files/data/src/CDFProbeSetInformation.o fusion/calvin_files/data/src/CDFQCProbeInformation.o fusion/calvin_files/data/src/CDFQCProbeSetInformation.o fusion/calvin_files/data/src/CELData.o fusion/calvin_files/data/src/CHPBackgroundZone.o fusion/calvin_files/data/src/CHPData.o fusion/calvin_files/data/src/CHPExpressionEntry.o fusion/calvin_files/data/src/CHPMultiDataData.o fusion/calvin_files/data/src/CHPTilingData.o fusion/calvin_files/data/src/CHPQuantificationData.o fusion/calvin_files/data/src/CHPQuantificationDetectionData.o fusion/calvin_files/data/src/CHPGenotypeEntry.o fusion/calvin_files/data/src/CHPUniversalEntry.o fusion/calvin_files/data/src/ColumnInfo.o fusion/calvin_files/data/src/DataGroup.o fusion/calvin_files/data/src/DataGroupHeader.o fusion/calvin_files/data/src/DataSet.o fusion/calvin_files/data/src/DataSetHeader.o fusion/calvin_files/data/src/FileHeader.o fusion/calvin_files/data/src/GenericData.o fusion/calvin_files/data/src/GenericDataHeader.o fusion/calvin_files/exception/src/ExceptionBase.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCELDataAdapter.o fusion/calvin_files/fusion/src/CalvinAdapter/CalvinCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionBPMAPData.o fusion/calvin_files/fusion/src/FusionCDFData.o fusion/calvin_files/fusion/src/FusionCDFQCProbeSetNames.o fusion/calvin_files/fusion/src/FusionCELData.o fusion/calvin_files/fusion/src/FusionCHPData.o fusion/calvin_files/fusion/src/FusionProbeSetResults.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCELDataAdapter.o fusion/calvin_files/fusion/src/GCOSAdapter/GCOSCHPDataAdapter.o fusion/calvin_files/fusion/src/FusionCHPLegacyData.o fusion/calvin_files/fusion/src/FusionCHPMultiDataAccessor.o fusion/calvin_files/fusion/src/FusionCHPMultiDataData.o fusion/calvin_files/fusion/src/FusionCHPTilingData.o fusion/calvin_files/fusion/src/FusionCHPGenericData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationData.o fusion/calvin_files/fusion/src/FusionCHPQuantificationDetectionData.o fusion/calvin_files/parameter/src/ParameterNameValueType.o fusion/calvin_files/parsers/src/CDFFileReader.o fusion/calvin_files/parsers/src/CelFileReader.o fusion/calvin_files/parsers/src/CHPFileReader.o fusion/calvin_files/parsers/src/CHPMultiDataFileReader.o fusion/calvin_files/parsers/src/CHPTilingFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationFileReader.o fusion/calvin_files/parsers/src/CHPQuantificationDetectionFileReader.o fusion/calvin_files/parsers/src/DataGroupHeaderReader.o fusion/calvin_files/parsers/src/DataGroupReader.o fusion/calvin_files/parsers/src/DataSetHeaderReader.o fusion/calvin_files/parsers/src/DataSetReader.o fusion/calvin_files/parsers/src/FileHeaderReader.o fusion/calvin_files/parsers/src/FileInput.o fusion/calvin_files/parsers/src/GenericDataHeaderReader.o fusion/calvin_files/parsers/src/GenericFileReader.o fusion/calvin_files/utils/src/AffymetrixGuid.o fusion/calvin_files/utils/src/DateTime.o fusion/calvin_files/utils/src/FileUtils.o fusion/calvin_files/utils/src/StringUtils.o fusion/calvin_files/utils/src/checksum.o fusion/file/BPMAPFileData.o fusion/file/BPMAPFileWriter.o fusion/file/CDFFileData.o fusion/file/CELFileData.o fusion/file/CHPFileData.o fusion/file/FileIO.o fusion/file/FileWriter.o fusion/file/TsvFile/ClfFile.o fusion/file/TsvFile/PgfFile.o fusion/file/TsvFile/TsvFile.o fusion/util/AffxByteArray.o fusion/util/AffxConv.o fusion/util/MsgStream.o fusion/util/Util.o fusion/util/Err.o fusion/util/Fs.o fusion/util/Verbose.o fusion/util/RowFile.o fusion/util/TableFile.o fusion/util/Convert.o R_affx_cel_parser.o R_affx_cdf_parser.o R_affx_cdf_extras.o R_affx_bpmap_parser.o R_affx_clf_pgf_parser.o R_affx_chp_parser.o 000.init.o -F/Library/Frameworks/R.framework/.. -framework R
installing to /Library/Frameworks/R.framework/Versions/4.6/Resources/library/00LOCK-affxparser/00new/affxparser/libs
** R
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** testing if installed package can be loaded from temporary location
** checking absolute paths in shared objects and dynamic libraries
** testing if installed package can be loaded from final location
** testing if installed package keeps a record of temporary installation path
* DONE (affxparser)
affxparser.Rcheck/tests/convertCel.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ ## rawData/
+ pathR <- system.file(package="AffymetrixDataTestFiles", mustWork=TRUE)
+ pathR <- file.path(pathR, "rawData")
+
+ ## File #1: Test3
+ chipType <- "Test3"
+ path <- file.path(pathR, "FusionSDK_Test3", chipType, "2.Calvin")
+ filename <- list.files(path=path, pattern="[.]CEL$")[1]
+ pathname <- file.path(path, filename)
+ hdr <- readCelHeader(pathname)
+ str(hdr)
+ stopifnot(hdr$chiptype == chipType)
+ filename4 <- gsub(".CEL", ",v4.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == hdr$chiptype)
+
+ ## New chip type
+ newChipType <- sprintf("%s-custom", chipType)
+ filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ ## FIXME
+ ## stopifnot(hdr4$chiptype == newChipType)
+
+
+ ## File #2: FusionSDK_HG-U133A
+ chipType <- "HG-U133A"
+ path <- file.path(pathR, "FusionSDK_HG-U133A", chipType, "2.Calvin")
+ filename <- list.files(path=path, pattern="[.]CEL$")[1]
+ pathname <- file.path(path, filename)
+ hdr <- readCelHeader(pathname)
+ str(hdr)
+ stopifnot(hdr$chiptype == chipType)
+ filename4 <- gsub(".CEL", ",v4.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == hdr$chiptype)
+
+ ## New chip type
+ newChipType <- sprintf("%s-custom", chipType)
+ filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == newChipType)
+
+
+ ## File #3: FusionSDK_Focus
+ chipType <- "HG-Focus"
+ path <- file.path(pathR, "FusionSDK_HG-Focus", chipType, "2.Calvin")
+ filename <- list.files(path=path, pattern="[.]CEL$")[1]
+ pathname <- file.path(path, filename)
+ hdr <- readCelHeader(pathname)
+ str(hdr)
+ stopifnot(hdr$chiptype == chipType)
+ filename4 <- gsub(".CEL", ",v4.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, verbose=TRUE, .validate=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ stopifnot(hdr4$chiptype == hdr$chiptype)
+
+ ## New chip type
+ newChipType <- sprintf("%s-custom", chipType)
+ filename4 <- gsub(".CEL", ",v4,custom.CEL", filename)
+ pathname4 <- convertCel(pathname, filename4, newChipType=newChipType, verbose=TRUE)
+ print(pathname4)
+ hdr4 <- readCelHeader(pathname4)
+ str(hdr4)
+ ## FIXME
+ ## stopifnot(hdr4$chiptype == newChipType)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 14
$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
$ version : int 1
$ cols : int 126
$ rows : int 126
$ total : int 15876
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
$ chiptype : chr "Test3"
$ header : chr ""
$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 5
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
CEL 1: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/Test3/2.Calvin/Test3-1-121502.CEL
CEL 2: ./Test3-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
Comparing CEL headers...
Comparing CEL headers...done
Comparing CEL data...
Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./Test3-1-121502,v4.CEL"
List of 14
$ filename : chr "./Test3-1-121502,v4.CEL"
$ version : int 4
$ cols : int 126
$ rows : int 126
$ total : int 15876
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
$ chiptype : chr "Test3"
$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 5
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'Test3' to 'Test3-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./Test3-1-121502,v4,custom.CEL"
List of 14
$ filename : chr "./Test3-1-121502,v4,custom.CEL"
$ version : int 4
$ cols : int 126
$ rows : int 126
$ total : int 15876
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
$ chiptype : chr "Test3"
$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 5
$ nmasked : int 0
List of 14
$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U13"| __truncated__
$ version : int 4
$ cols : int 712
$ rows : int 712
$ total : int 506944
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
$ chiptype : chr "HG-U133A"
$ header : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
$ datheader : chr "[46..48458] ethan1-1:CLS=5377 RWS=5377 XIN=2 YIN=2 VE=30 2.0 11/10/04 18:23:42 M10SIM M10 \024 \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 2085
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
CEL 1: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-U133A/HG-U133A/2.Calvin/ethan1-1.CEL
CEL 2: ./ethan1-1,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
Comparing CEL headers...
Comparing CEL headers...done
Comparing CEL data...
Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./ethan1-1,v4.CEL"
List of 14
$ filename : chr "./ethan1-1,v4.CEL"
$ version : int 4
$ cols : int 712
$ rows : int 712
$ total : int 506944
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
$ chiptype : chr "HG-U133A"
$ header : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
$ datheader : chr "[46..48458] ethan1-1:CLS=5377 RWS=5377 XIN=2 YIN=2 VE=30 2.0 11/10/04 18:23:42 M10SIM M10 \024 \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 2085
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-U133A' to 'HG-U133A-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./ethan1-1,v4,custom.CEL"
List of 14
$ filename : chr "./ethan1-1,v4,custom.CEL"
$ version : int 4
$ cols : int 712
$ rows : int 712
$ total : int 506944
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:FALSE;IgnoreOutliers"| __truncated__
$ chiptype : chr "HG-U133A-custom"
$ header : chr "Cols=712\nRows=712\nTotalX=712\nTotalY=712\nOffsetX=0\nOffsetY=0\nGridCornerUL=185 257\nGridCornerUR=5111 229\n"| __truncated__
$ datheader : chr "[46..48458] ethan1-1:CLS=5377 RWS=5377 XIN=2 YIN=2 VE=30 2.0 11/10/04 18:23:42 M10SIM M10 \024 \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 2085
$ nmasked : int 0
List of 14
$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Foc"| __truncated__
$ version : int 1
$ cols : int 448
$ rows : int 448
$ total : int 200704
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
$ chiptype : chr "HG-Focus"
$ header : chr ""
$ datheader : chr "[7..46138] B1:CLS=2920 RWS=2920 XIN=3 YIN=3 VE=17 2.0 05/15/02 11:07:10 \024 \024 HG-Focus.1sq \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 508
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
Validating CEL file...
Comparing CELs...
CEL 1: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_HG-Focus/HG-Focus/2.Calvin/HG-Focus-1-121502.CEL
CEL 2: ./HG-Focus-1-121502,v4.CEL
Reading first...
Reading first...done
Reading second...
Reading second...done
Comparing CEL headers...
Comparing CEL headers...done
Comparing CEL data...
Comparing CEL data...done
Comparing CELs...done
Validating CEL file...done
[1] "./HG-Focus-1-121502,v4.CEL"
List of 14
$ filename : chr "./HG-Focus-1-121502,v4.CEL"
$ version : int 4
$ cols : int 448
$ rows : int 448
$ total : int 200704
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
$ chiptype : chr "HG-Focus"
$ header : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
$ datheader : chr "[7..46138] B1:CLS=2920 RWS=2920 XIN=3 YIN=3 VE=17 2.0 05/15/02 11:07:10 \024 \024 HG-Focus.1sq \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 508
$ nmasked : int 0
Reading CEL file...
Reading CEL file...done
Updating the chip type label from 'HG-Focus' to 'HG-Focus-custom'.
Creating empty CEL file...
Creating empty CEL file...done
Updating CEL file...
Updating CEL file...done
[1] "./HG-Focus-1-121502,v4,custom.CEL"
List of 14
$ filename : chr "./HG-Focus-1-121502,v4,custom.CEL"
$ version : int 4
$ cols : int 448
$ rows : int 448
$ total : int 200704
$ algorithm : chr "Percentile"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:62.000000;GridULY:117.000000;GridURX:2748"| __truncated__
$ chiptype : chr "HG-Focus"
$ header : chr "Cols=448\nRows=448\nTotalX=448\nTotalY=448\nOffsetX=0\nOffsetY=0\nGridCornerUL=62 117\nGridCornerUR=2748 119\nG"| __truncated__
$ datheader : chr "[7..46138] B1:CLS=2920 RWS=2920 XIN=3 YIN=3 VE=17 2.0 05/15/02 11:07:10 \024 \024 HG-Focus.1sq \0"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 508
$ nmasked : int 0
>
> proc.time()
user system elapsed
0.902 0.095 1.033
affxparser.Rcheck/tests/readCdfDataFrame.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nunits
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read full file
+ data <- readCdfDataFrame(cdf)
+ str(data)
+ stopifnot(length(unique(data$unitName)) == Jall)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCdfDataFrame() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCdfDataFrame(cdf, units=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCdfDataFrame(cdf, units=idxs)
+ str(data)
+ units <- if (is.null(idxs)) seq_len(Jall) else as.integer(idxs)
+ stopifnot(length(unique(data$unitName)) == length(units))
+ stopifnot(identical(sort(unique(data$unit)), units))
+ }
+ message(sprintf("Testing readCdfDataFrame() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
'data.frame': 12708 obs. of 16 variables:
$ unit : int 1 1 1 1 1 1 1 1 1 1 ...
$ unitName : chr "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
$ unitType : chr "expression" "expression" "expression" "expression" ...
$ unitDirection : chr "antisense" "antisense" "antisense" "antisense" ...
$ unitNbrOfAtoms : int 16 16 16 16 16 16 16 16 16 16 ...
$ group : int 1 1 1 1 1 1 1 1 1 1 ...
$ groupName : chr "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
$ groupDirection : chr "antisense" "antisense" "antisense" "antisense" ...
$ groupNbrOfAtoms: int 16 16 16 16 16 16 16 16 16 16 ...
$ cell : int 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
$ x : int 111 111 19 19 95 95 18 18 25 25 ...
$ y : int 79 80 19 20 39 40 55 56 113 114 ...
$ pbase : chr "t" "a" "a" "t" ...
$ tbase : chr "a" "a" "t" "t" ...
$ indexPos : int 0 0 1 1 2 2 3 3 4 4 ...
$ atom : int 0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readAll' indices...
List of 1
$ idxs: NULL
'data.frame': 12708 obs. of 16 variables:
$ unit : int 1 1 1 1 1 1 1 1 1 1 ...
$ unitName : chr "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
$ unitType : chr "expression" "expression" "expression" "expression" ...
$ unitDirection : chr "antisense" "antisense" "antisense" "antisense" ...
$ unitNbrOfAtoms : int 16 16 16 16 16 16 16 16 16 16 ...
$ group : int 1 1 1 1 1 1 1 1 1 1 ...
$ groupName : chr "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" "Pae_16SrRNA_s_at" ...
$ groupDirection : chr "antisense" "antisense" "antisense" "antisense" ...
$ groupNbrOfAtoms: int 16 16 16 16 16 16 16 16 16 16 ...
$ cell : int 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
$ x : int 111 111 19 19 95 95 18 18 25 25 ...
$ y : int 79 80 19 20 39 40 55 56 113 114 ...
$ pbase : chr "t" "a" "a" "t" ...
$ tbase : chr "a" "a" "t" "t" ...
$ indexPos : int 0 0 1 1 2 2 3 3 4 4 ...
$ atom : int 0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readAll' indices...done
Testing readCdfDataFrame() with 'readOne' indices...
List of 1
$ idxs: int 10
'data.frame': 24 obs. of 16 variables:
$ unit : int 10 10 10 10 10 10 10 10 10 10 ...
$ unitName : chr "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" ...
$ unitType : chr "expression" "expression" "expression" "expression" ...
$ unitDirection : chr "sense" "sense" "sense" "sense" ...
$ unitNbrOfAtoms : int 12 12 12 12 12 12 12 12 12 12 ...
$ group : int 1 1 1 1 1 1 1 1 1 1 ...
$ groupName : chr "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" "PA1178_oprH_st" ...
$ groupDirection : chr "sense" "sense" "sense" "sense" ...
$ groupNbrOfAtoms: int 12 12 12 12 12 12 12 12 12 12 ...
$ cell : int 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
$ x : int 37 37 79 79 68 68 51 51 79 79 ...
$ y : int 33 34 67 68 65 66 111 112 43 44 ...
$ pbase : chr "t" "a" "c" "g" ...
$ tbase : chr "a" "a" "g" "g" ...
$ indexPos : int 0 0 1 1 2 2 3 3 4 4 ...
$ atom : int 0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readOne' indices...done
Testing readCdfDataFrame() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
'data.frame': 288 obs. of 16 variables:
$ unit : int 11 11 11 11 11 11 11 11 11 11 ...
$ unitName : chr "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
$ unitType : chr "expression" "expression" "expression" "expression" ...
$ unitDirection : chr "sense" "sense" "sense" "sense" ...
$ unitNbrOfAtoms : int 12 12 12 12 12 12 12 12 12 12 ...
$ group : int 1 1 1 1 1 1 1 1 1 1 ...
$ groupName : chr "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
$ groupDirection : chr "sense" "sense" "sense" "sense" ...
$ groupNbrOfAtoms: int 12 12 12 12 12 12 12 12 12 12 ...
$ cell : int 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
$ x : int 15 15 35 35 83 83 113 113 119 119 ...
$ y : int 45 46 57 58 55 56 17 18 65 66 ...
$ pbase : chr "t" "a" "t" "a" ...
$ tbase : chr "a" "a" "a" "a" ...
$ indexPos : int 0 0 1 1 2 2 3 3 4 4 ...
$ atom : int 0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readSome' indices...done
Testing readCdfDataFrame() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
'data.frame': 288 obs. of 16 variables:
$ unit : int 11 11 11 11 11 11 11 11 11 11 ...
$ unitName : chr "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
$ unitType : chr "expression" "expression" "expression" "expression" ...
$ unitDirection : chr "sense" "sense" "sense" "sense" ...
$ unitNbrOfAtoms : int 12 12 12 12 12 12 12 12 12 12 ...
$ group : int 1 1 1 1 1 1 1 1 1 1 ...
$ groupName : chr "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" "PA1816_dnaQ_st" ...
$ groupDirection : chr "sense" "sense" "sense" "sense" ...
$ groupNbrOfAtoms: int 12 12 12 12 12 12 12 12 12 12 ...
$ cell : int 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
$ x : int 15 15 35 35 83 83 113 113 119 119 ...
$ y : int 45 46 57 58 55 56 17 18 65 66 ...
$ pbase : chr "t" "a" "t" "a" ...
$ tbase : chr "a" "a" "a" "a" ...
$ indexPos : int 0 0 1 1 2 2 3 3 4 4 ...
$ atom : int 0 0 1 1 2 2 3 3 4 4 ...
Testing readCdfDataFrame() with 'readDouble' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains non-positive indices."
$ call : language readCdfDataFrame(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains non-positive indices."
$ call : language readCdfDataFrame(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Testing readCdfDataFrame() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,345]: 1000000000"
$ call : language readCdf(filename, units = units, readXY = readXY, readBases = readBases, readIndexpos = readIndexpos, readAt| __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfDataFrame() with 'outOfRange' indices...done
Warning messages:
1: In readCdfDataFrame(cdf) : Some of the fields were not read: expos
2: In readCdfDataFrame(cdf, units = idxs) :
Some of the fields were not read: expos
3: In readCdfDataFrame(cdf, units = idxs) :
Some of the fields were not read: expos
4: In readCdfDataFrame(cdf, units = idxs) :
Some of the fields were not read: expos
5: In readCdfDataFrame(cdf, units = idxs) :
Some of the fields were not read: expos
>
> proc.time()
user system elapsed
0.631 0.057 0.696
affxparser.Rcheck/tests/readCdfQc.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nqcunits
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=5L,
+ readSome=5:10,
+ readDouble=as.double(5:10),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read full file
+ data <- readCdfQc(cdf)
+ str(head(data))
+ stopifnot(length(data) == Jall)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCdfQc() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCdfQc(cdf, units=idxs)
+ str(head(data))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data) == J)
+ }
+ message(sprintf("Testing readCdfQc() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ :List of 8
..$ x : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
..$ y : int [1:300] 82 83 84 85 86 82 83 84 85 86 ...
..$ indices : int [1:300] 10410 10536 10662 10788 10914 10411 10537 10663 10789 10915 ...
..$ length : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
..$ pm : logi [1:300] FALSE TRUE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
..$ type : chr "geneExpNegative"
..$ ncells : int 300
$ :List of 8
..$ x : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
..$ y : int [1:300] 80 79 78 77 81 80 79 78 77 81 ...
..$ indices : int [1:300] 10158 10032 9906 9780 10284 10159 10033 9907 9781 10285 ...
..$ length : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
..$ pm : logi [1:300] FALSE FALSE TRUE FALSE FALSE FALSE ...
..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
..$ type : chr "geneExpPositive"
..$ ncells : int 300
$ :List of 8
..$ x : int [1:204] 120 118 116 114 112 110 108 106 104 102 ...
..$ y : int [1:204] 0 0 0 0 0 0 0 0 0 0 ...
..$ indices : int [1:204] 121 119 117 115 113 111 109 107 105 103 ...
..$ length : int [1:204] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "crossHybeNegative"
..$ ncells : int 204
$ :List of 8
..$ x : int [1:32] 1 124 122 3 124 122 2 123 125 0 ...
..$ y : int [1:32] 1 0 0 1 2 2 0 1 1 2 ...
..$ indices : int [1:32] 128 125 123 130 377 375 3 250 252 253 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardPositive"
..$ ncells : int 32
$ :List of 8
..$ x : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
..$ y : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
..$ indices : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardNegative"
..$ ncells : int 32
$ :List of 8
..$ x : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
..$ y : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
..$ indices : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
..$ length : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "crossHybePositive"
..$ ncells : int 208
Testing readCdfQc() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ :List of 8
..$ x : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
..$ y : int [1:300] 82 83 84 85 86 82 83 84 85 86 ...
..$ indices : int [1:300] 10410 10536 10662 10788 10914 10411 10537 10663 10789 10915 ...
..$ length : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
..$ pm : logi [1:300] FALSE TRUE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
..$ type : chr "geneExpNegative"
..$ ncells : int 300
$ :List of 8
..$ x : int [1:300] 77 77 77 77 77 78 78 78 78 78 ...
..$ y : int [1:300] 80 79 78 77 81 80 79 78 77 81 ...
..$ indices : int [1:300] 10158 10032 9906 9780 10284 10159 10033 9907 9781 10285 ...
..$ length : int [1:300] 20 20 20 20 1 20 20 20 20 1 ...
..$ pm : logi [1:300] FALSE FALSE TRUE FALSE FALSE FALSE ...
..$ background: logi [1:300] FALSE FALSE FALSE FALSE TRUE FALSE ...
..$ type : chr "geneExpPositive"
..$ ncells : int 300
$ :List of 8
..$ x : int [1:204] 120 118 116 114 112 110 108 106 104 102 ...
..$ y : int [1:204] 0 0 0 0 0 0 0 0 0 0 ...
..$ indices : int [1:204] 121 119 117 115 113 111 109 107 105 103 ...
..$ length : int [1:204] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:204] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "crossHybeNegative"
..$ ncells : int 204
$ :List of 8
..$ x : int [1:32] 1 124 122 3 124 122 2 123 125 0 ...
..$ y : int [1:32] 1 0 0 1 2 2 0 1 1 2 ...
..$ indices : int [1:32] 128 125 123 130 377 375 3 250 252 253 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardPositive"
..$ ncells : int 32
$ :List of 8
..$ x : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
..$ y : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
..$ indices : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardNegative"
..$ ncells : int 32
$ :List of 8
..$ x : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
..$ y : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
..$ indices : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
..$ length : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "crossHybePositive"
..$ ncells : int 208
Testing readCdfQc() with 'readAll' indices...done
Testing readCdfQc() with 'readOne' indices...
List of 1
$ idxs: int 5
List of 1
$ :List of 8
..$ x : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
..$ y : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
..$ indices : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardNegative"
..$ ncells : int 32
Testing readCdfQc() with 'readOne' indices...done
Testing readCdfQc() with 'readSome' indices...
List of 1
$ idxs: int [1:6] 5 6 7 8 9 10
List of 6
$ :List of 8
..$ x : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
..$ y : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
..$ indices : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardNegative"
..$ ncells : int 32
$ :List of 8
..$ x : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
..$ y : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
..$ indices : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
..$ length : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "crossHybePositive"
..$ ncells : int 208
$ :List of 8
..$ x : int [1:24] 85 43 85 43 85 43 85 43 85 125 ...
..$ y : int [1:24] 0 1 1 2 2 0 125 125 124 36 ...
..$ indices : int [1:24] 86 170 212 296 338 44 15836 15794 15710 4662 ...
..$ length : int [1:24] 20 18 18 16 16 20 20 20 18 16 ...
..$ pm : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "hybePositive"
..$ ncells : int 24
$ :List of 8
..$ x : int [1:24] 83 41 41 83 41 83 83 41 0 83 ...
..$ y : int [1:24] 0 0 1 1 2 2 125 125 80 124 ...
..$ indices : int [1:24] 84 42 168 210 294 336 15834 15792 10081 15708 ...
..$ length : int [1:24] 20 20 18 18 16 16 20 20 20 18 ...
..$ pm : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "hybeNegative"
..$ ncells : int 24
$ :List of 8
..$ x : int [1:294] 12 16 18 19 20 21 22 24 25 26 ...
..$ y : int [1:294] 9 9 9 9 9 9 9 9 9 9 ...
..$ indices : int [1:294] 1147 1151 1153 1154 1155 1156 1157 1159 1160 1161 ...
..$ length : int [1:294] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "textFeaturesPositive"
..$ ncells : int 294
$ :List of 8
..$ x : int [1:161] 13 14 15 37 38 39 42 66 67 68 ...
..$ y : int [1:161] 9 9 9 9 9 9 9 9 9 9 ...
..$ indices : int [1:161] 1148 1149 1150 1172 1173 1174 1177 1201 1202 1203 ...
..$ length : int [1:161] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "textFeaturesNegative"
..$ ncells : int 161
Testing readCdfQc() with 'readSome' indices...done
Testing readCdfQc() with 'readDouble' indices...
List of 1
$ idxs: num [1:6] 5 6 7 8 9 10
List of 6
$ :List of 8
..$ x : int [1:32] 0 125 123 2 3 124 3 1 122 124 ...
..$ y : int [1:32] 1 0 0 1 2 3 0 0 1 1 ...
..$ indices : int [1:32] 127 126 124 129 256 503 4 2 249 251 ...
..$ length : int [1:32] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:32] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "checkerboardNegative"
..$ ncells : int 32
$ :List of 8
..$ x : int [1:208] 119 117 115 113 111 109 107 105 103 101 ...
..$ y : int [1:208] 0 0 0 0 0 0 0 0 0 0 ...
..$ indices : int [1:208] 120 118 116 114 112 110 108 106 104 102 ...
..$ length : int [1:208] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:208] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "crossHybePositive"
..$ ncells : int 208
$ :List of 8
..$ x : int [1:24] 85 43 85 43 85 43 85 43 85 125 ...
..$ y : int [1:24] 0 1 1 2 2 0 125 125 124 36 ...
..$ indices : int [1:24] 86 170 212 296 338 44 15836 15794 15710 4662 ...
..$ length : int [1:24] 20 18 18 16 16 20 20 20 18 16 ...
..$ pm : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "hybePositive"
..$ ncells : int 24
$ :List of 8
..$ x : int [1:24] 83 41 41 83 41 83 83 41 0 83 ...
..$ y : int [1:24] 0 0 1 1 2 2 125 125 80 124 ...
..$ indices : int [1:24] 84 42 168 210 294 336 15834 15792 10081 15708 ...
..$ length : int [1:24] 20 20 18 18 16 16 20 20 20 18 ...
..$ pm : logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:24] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "hybeNegative"
..$ ncells : int 24
$ :List of 8
..$ x : int [1:294] 12 16 18 19 20 21 22 24 25 26 ...
..$ y : int [1:294] 9 9 9 9 9 9 9 9 9 9 ...
..$ indices : int [1:294] 1147 1151 1153 1154 1155 1156 1157 1159 1160 1161 ...
..$ length : int [1:294] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:294] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "textFeaturesPositive"
..$ ncells : int 294
$ :List of 8
..$ x : int [1:161] 13 14 15 37 38 39 42 66 67 68 ...
..$ y : int [1:161] 9 9 9 9 9 9 9 9 9 9 ...
..$ indices : int [1:161] 1148 1149 1150 1172 1173 1174 1177 1201 1202 1203 ...
..$ length : int [1:161] 25 25 25 25 25 25 25 25 25 25 ...
..$ pm : logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ background: logi [1:161] FALSE FALSE FALSE FALSE FALSE FALSE ...
..$ type : chr "textFeaturesNegative"
..$ ncells : int 161
Testing readCdfQc() with 'readDouble' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
Testing readCdfQc() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfQc() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.152 0.040 0.189
affxparser.Rcheck/tests/readCdfUnits_etal.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nunits
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ fcnNames <- c(
+ "readCdf",
+ "readCdfUnits",
+ "readCdfUnitNames",
+ "readCdfNbrOfCellsPerUnitGroup",
+ "readCdfGroupNames",
+ "readCdfCellIndices",
+ "readCdfIsPm"
+ )
+
+ # Read full file
+ for (fcnName in fcnNames) {
+ fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+ data <- fcn(cdf)
+ str(head(data))
+ stopifnot(length(data) == Jall)
+ } # for (fcn ...)
+
+ for (fcnName in fcnNames) {
+ fcn <- get(fcnName, mode="function", envir=getNamespace("affxparser"))
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing %s() with '%s' indices...", fcnName, name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCdfQc(cdf, units=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- fcn(cdf, units=idxs)
+ str(head(data))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data) == J)
+ }
+ message(sprintf("Testing %s() with '%s' indices...done", fcnName, name))
+ } # for (ii ...)
+ } # for (fcn ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ Pae_16SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1000
$ Pae_23SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1001
$ PA1178_oprH_at :List of 7
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 9
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1002
$ PA1816_dnaQ_at :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 9
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1003
$ PA3183_zwf_at :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 9
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1004
$ PA3640_dnaE_at :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 9
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1005
List of 6
$ Pae_16SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ Pae_23SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1178_oprH_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 6
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1816_dnaQ_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 6
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3183_zwf_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 6
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3640_dnaE_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 6
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
List of 6
$ Pae_16SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
$ Pae_23SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
$ PA1178_oprH_at : Named int 24
..- attr(*, "names")= chr "PA1178_oprH_at"
$ PA1816_dnaQ_at : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_at"
$ PA3183_zwf_at : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_at"
$ PA3640_dnaE_at : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_at"
List of 6
$ Pae_16SrRNA_s_at: chr ""
$ Pae_23SrRNA_s_at: chr ""
$ PA1178_oprH_at : chr ""
$ PA1816_dnaQ_at : chr ""
$ PA3183_zwf_at : chr ""
$ PA3640_dnaE_at : chr ""
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_16SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
$ Pae_23SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_23SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
$ PA1178_oprH_at :List of 1
..$ groups:List of 1
.. ..$ PA1178_oprH_at:List of 1
.. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
$ PA1816_dnaQ_at :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_at:List of 1
.. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
$ PA3183_zwf_at :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_at:List of 1
.. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
$ PA3640_dnaE_at :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_at:List of 1
.. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdf() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1000
$ Pae_23SrRNA_s_at:List of 7
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 9
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1001
$ PA1178_oprH_at :List of 7
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 9
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1002
$ PA1816_dnaQ_at :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 9
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1003
$ PA3183_zwf_at :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 9
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1004
$ PA3640_dnaE_at :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 9
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1005
Testing readCdf() with 'readAll' indices...done
Testing readCdf() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 7
..$ groups :List of 1
.. ..$ PA1178_oprH_st:List of 9
.. .. ..$ x : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
.. .. ..$ y : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "c" "g" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "g" "g" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1052
Testing readCdf() with 'readOne' indices...done
Testing readCdf() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 9
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1053
$ PA3183_zwf_st :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 9
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1054
$ PA3640_dnaE_st :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 9
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1055
$ PA4407_ftsZ_st :List of 7
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 9
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1056
$ AFFX-Athal-Actin_5_r_at:List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 9
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1100
$ AFFX-Athal-Actin_M_at :List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 9
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1101
Testing readCdf() with 'readSome' indices...done
Testing readCdf() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 7
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 9
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1053
$ PA3183_zwf_st :List of 7
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 9
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1054
$ PA3640_dnaE_st :List of 7
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 9
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1055
$ PA4407_ftsZ_st :List of 7
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 9
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ atom : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "sense"
.. .. ..$ natoms : int 12
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "sense"
..$ natoms : int 12
..$ ncells : int 24
..$ ncellsperatom: int 2
..$ unitnumber : int 1056
$ AFFX-Athal-Actin_5_r_at:List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 9
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1100
$ AFFX-Athal-Actin_M_at :List of 7
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 9
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ atom : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ indexpos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ groupdirection: chr "antisense"
.. .. ..$ natoms : int 16
.. .. ..$ ncellsperatom : int 2
..$ unittype : chr "expression"
..$ unitdirection: chr "antisense"
..$ natoms : int 16
..$ ncells : int 32
..$ ncellsperatom: int 2
..$ unitnumber : int 1101
Testing readCdf() with 'readDouble' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdf() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdf() with 'outOfRange' indices...done
Testing readCdfUnits() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_16SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 111 111 19 19 95 95 18 18 25 25 ...
.. .. ..$ y : int [1:32] 79 80 19 20 39 40 55 56 113 114 ...
.. .. ..$ pbase : chr [1:32] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:32] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ Pae_23SrRNA_s_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ Pae_23SrRNA_s_at:List of 6
.. .. ..$ x : int [1:32] 124 124 56 56 1 1 85 85 62 62 ...
.. .. ..$ y : int [1:32] 95 96 99 100 23 24 41 42 9 10 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1178_oprH_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1178_oprH_at:List of 6
.. .. ..$ x : int [1:24] 41 41 117 117 110 110 60 60 41 41 ...
.. .. ..$ y : int [1:24] 49 50 45 46 41 42 75 76 47 48 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "g" "c" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "c" "c" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA1816_dnaQ_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA1816_dnaQ_at:List of 6
.. .. ..$ x : int [1:24] 21 21 68 68 119 119 62 62 118 118 ...
.. .. ..$ y : int [1:24] 105 106 41 42 49 50 37 38 97 98 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3183_zwf_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3183_zwf_at:List of 6
.. .. ..$ x : int [1:24] 104 104 106 106 79 79 53 53 77 77 ...
.. .. ..$ y : int [1:24] 91 92 19 20 27 28 75 76 19 20 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ PA3640_dnaE_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ PA3640_dnaE_at:List of 6
.. .. ..$ x : int [1:24] 113 113 81 81 10 10 110 110 119 119 ...
.. .. ..$ y : int [1:24] 41 42 27 28 45 46 103 104 91 92 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "a" "t" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "t" "t" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
Testing readCdfUnits() with 'readAll' indices...done
Testing readCdfUnits() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA1178_oprH_st:List of 6
.. .. ..$ x : int [1:24] 37 37 79 79 68 68 51 51 79 79 ...
.. .. ..$ y : int [1:24] 33 34 67 68 65 66 111 112 43 44 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "c" "g" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "g" "g" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
Testing readCdfUnits() with 'readOne' indices...done
Testing readCdfUnits() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 6
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3183_zwf_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 6
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3640_dnaE_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 6
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA4407_ftsZ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 6
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ AFFX-Athal-Actin_5_r_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 6
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ AFFX-Athal-Actin_M_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 6
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
Testing readCdfUnits() with 'readSome' indices...done
Testing readCdfUnits() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA1816_dnaQ_st:List of 6
.. .. ..$ x : int [1:24] 15 15 35 35 83 83 113 113 119 119 ...
.. .. ..$ y : int [1:24] 45 46 57 58 55 56 17 18 65 66 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3183_zwf_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3183_zwf_st:List of 6
.. .. ..$ x : int [1:24] 84 84 57 57 8 8 89 89 52 52 ...
.. .. ..$ y : int [1:24] 101 102 113 114 27 28 17 18 107 108 ...
.. .. ..$ pbase : chr [1:24] "a" "t" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "t" "t" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA3640_dnaE_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA3640_dnaE_st:List of 6
.. .. ..$ x : int [1:24] 51 51 37 37 121 121 9 9 65 65 ...
.. .. ..$ y : int [1:24] 75 76 25 26 23 24 23 24 57 58 ...
.. .. ..$ pbase : chr [1:24] "t" "a" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "a" "a" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ PA4407_ftsZ_st :List of 3
..$ type : int 1
..$ direction: int 1
..$ groups :List of 1
.. ..$ PA4407_ftsZ_st:List of 6
.. .. ..$ x : int [1:24] 69 69 124 124 102 102 19 19 102 102 ...
.. .. ..$ y : int [1:24] 87 88 97 98 35 36 101 102 11 12 ...
.. .. ..$ pbase : chr [1:24] "g" "c" "t" "a" ...
.. .. ..$ tbase : chr [1:24] "c" "c" "a" "a" ...
.. .. ..$ expos : int [1:24] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 1
$ AFFX-Athal-Actin_5_r_at:List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 6
.. .. ..$ x : int [1:32] 25 25 80 80 105 105 65 65 104 104 ...
.. .. ..$ y : int [1:32] 51 52 23 24 75 76 87 88 73 74 ...
.. .. ..$ pbase : chr [1:32] "c" "g" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "g" "g" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
$ AFFX-Athal-Actin_M_at :List of 3
..$ type : int 1
..$ direction: int 2
..$ groups :List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 6
.. .. ..$ x : int [1:32] 28 28 8 8 7 7 21 21 41 41 ...
.. .. ..$ y : int [1:32] 115 116 97 98 97 98 87 88 99 100 ...
.. .. ..$ pbase : chr [1:32] "a" "t" "c" "g" ...
.. .. ..$ tbase : chr [1:32] "t" "t" "g" "g" ...
.. .. ..$ expos : int [1:32] 0 0 1 1 2 2 3 3 4 4 ...
.. .. ..$ direction: int 2
Testing readCdfUnits() with 'readDouble' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnits() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'readAll' indices...
List of 1
$ idxs: NULL
chr [1:6] "Pae_16SrRNA_s_at" "Pae_23SrRNA_s_at" "PA1178_oprH_at" ...
Testing readCdfUnitNames() with 'readAll' indices...done
Testing readCdfUnitNames() with 'readOne' indices...
List of 1
$ idxs: int 10
chr "PA1178_oprH_st"
Testing readCdfUnitNames() with 'readOne' indices...done
Testing readCdfUnitNames() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readSome' indices...done
Testing readCdfUnitNames() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
chr [1:6] "PA1816_dnaQ_st" "PA3183_zwf_st" "PA3640_dnaE_st" ...
Testing readCdfUnitNames() with 'readDouble' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfUnitNames() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitNames() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_16SrRNA_s_at"
$ Pae_23SrRNA_s_at: Named int 32
..- attr(*, "names")= chr "Pae_23SrRNA_s_at"
$ PA1178_oprH_at : Named int 24
..- attr(*, "names")= chr "PA1178_oprH_at"
$ PA1816_dnaQ_at : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_at"
$ PA3183_zwf_at : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_at"
$ PA3640_dnaE_at : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readAll' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st: Named int 24
..- attr(*, "names")= chr "PA1178_oprH_st"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readOne' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_st"
$ PA3183_zwf_st : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_st"
$ PA3640_dnaE_st : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_st"
$ PA4407_ftsZ_st : Named int 24
..- attr(*, "names")= chr "PA4407_ftsZ_st"
$ AFFX-Athal-Actin_5_r_at: Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
$ AFFX-Athal-Actin_M_at : Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readSome' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : Named int 24
..- attr(*, "names")= chr "PA1816_dnaQ_st"
$ PA3183_zwf_st : Named int 24
..- attr(*, "names")= chr "PA3183_zwf_st"
$ PA3640_dnaE_st : Named int 24
..- attr(*, "names")= chr "PA3640_dnaE_st"
$ PA4407_ftsZ_st : Named int 24
..- attr(*, "names")= chr "PA4407_ftsZ_st"
$ AFFX-Athal-Actin_5_r_at: Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_5_r_at"
$ AFFX-Athal-Actin_M_at : Named int 32
..- attr(*, "names")= chr "AFFX-Athal-Actin_M_at"
Testing readCdfNbrOfCellsPerUnitGroup() with 'readDouble' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfNbrOfCellsPerUnitGroup() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at: chr ""
$ Pae_23SrRNA_s_at: chr ""
$ PA1178_oprH_at : chr ""
$ PA1816_dnaQ_at : chr ""
$ PA3183_zwf_at : chr ""
$ PA3640_dnaE_at : chr ""
Testing readCdfGroupNames() with 'readAll' indices...done
Testing readCdfGroupNames() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st: chr ""
Testing readCdfGroupNames() with 'readOne' indices...done
Testing readCdfGroupNames() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : chr ""
$ PA3183_zwf_st : chr ""
$ PA3640_dnaE_st : chr ""
$ PA4407_ftsZ_st : chr ""
$ AFFX-Athal-Actin_5_r_at: chr ""
$ AFFX-Athal-Actin_M_at : chr ""
Testing readCdfGroupNames() with 'readSome' indices...done
Testing readCdfGroupNames() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st : chr ""
$ PA3183_zwf_st : chr ""
$ PA3640_dnaE_st : chr ""
$ PA4407_ftsZ_st : chr ""
$ AFFX-Athal-Actin_5_r_at: chr ""
$ AFFX-Athal-Actin_M_at : chr ""
Testing readCdfGroupNames() with 'readDouble' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfGroupNames() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfGroupNames() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_16SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
$ Pae_23SrRNA_s_at:List of 1
..$ groups:List of 1
.. ..$ Pae_23SrRNA_s_at:List of 1
.. .. ..$ indices: int [1:32] 12095 12221 12531 12657 2900 3026 5252 5378 1197 1323 ...
$ PA1178_oprH_at :List of 1
..$ groups:List of 1
.. ..$ PA1178_oprH_at:List of 1
.. .. ..$ indices: int [1:24] 6216 6342 5788 5914 5277 5403 9511 9637 5964 6090 ...
$ PA1816_dnaQ_at :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_at:List of 1
.. .. ..$ indices: int [1:24] 13252 13378 5235 5361 6294 6420 4725 4851 12341 12467 ...
$ PA3183_zwf_at :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_at:List of 1
.. .. ..$ indices: int [1:24] 11571 11697 2501 2627 3482 3608 9504 9630 2472 2598 ...
$ PA3640_dnaE_at :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_at:List of 1
.. .. ..$ indices: int [1:24] 5280 5406 3484 3610 5681 5807 13089 13215 11586 11712 ...
Testing readCdfCellIndices() with 'readAll' indices...done
Testing readCdfCellIndices() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 1
..$ groups:List of 1
.. ..$ PA1178_oprH_st:List of 1
.. .. ..$ indices: int [1:24] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfCellIndices() with 'readOne' indices...done
Testing readCdfCellIndices() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_st:List of 1
.. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
$ PA3183_zwf_st :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_st:List of 1
.. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
$ PA3640_dnaE_st :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_st:List of 1
.. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
$ PA4407_ftsZ_st :List of 1
..$ groups:List of 1
.. ..$ PA4407_ftsZ_st:List of 1
.. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 1
.. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 1
.. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readSome' indices...done
Testing readCdfCellIndices() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ groups:List of 1
.. ..$ PA1816_dnaQ_st:List of 1
.. .. ..$ indices: int [1:24] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
$ PA3183_zwf_st :List of 1
..$ groups:List of 1
.. ..$ PA3183_zwf_st:List of 1
.. .. ..$ indices: int [1:24] 12811 12937 14296 14422 3411 3537 2232 2358 13535 13661 ...
$ PA3640_dnaE_st :List of 1
..$ groups:List of 1
.. ..$ PA3640_dnaE_st:List of 1
.. .. ..$ indices: int [1:24] 9502 9628 3188 3314 3020 3146 2908 3034 7248 7374 ...
$ PA4407_ftsZ_st :List of 1
..$ groups:List of 1
.. ..$ PA4407_ftsZ_st:List of 1
.. .. ..$ indices: int [1:24] 11032 11158 12347 12473 4513 4639 12746 12872 1489 1615 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_5_r_at:List of 1
.. .. ..$ indices: int [1:32] 6452 6578 2979 3105 9556 9682 11028 11154 9303 9429 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ groups:List of 1
.. ..$ AFFX-Athal-Actin_M_at:List of 1
.. .. ..$ indices: int [1:32] 14519 14645 12231 12357 12230 12356 10984 11110 12516 12642 ...
Testing readCdfCellIndices() with 'readDouble' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfCellIndices() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfCellIndices() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readAll' indices...done
Testing readCdfIsPm() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 1
..$ PA1178_oprH_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readOne' indices...done
Testing readCdfIsPm() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readSome' indices...done
Testing readCdfIsPm() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st: logi [1:24] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at: logi [1:32] TRUE FALSE TRUE FALSE TRUE FALSE ...
Testing readCdfIsPm() with 'readDouble' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: -1"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 0"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
Testing readCdfIsPm() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range [1,13]: 1000000000"
$ call : language readCdfQc(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfIsPm() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.326 0.093 0.421
affxparser.Rcheck/tests/readCdfUnitsWriteMap.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nunits
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read full file
+ data <- readCdfUnitsWriteMap(cdf)
+ str(data)
+ Jall <- length(data)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCdfUnitsWriteMap() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCdfUnitsWriteMap(cdf, units=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCdfUnitsWriteMap(cdf, units=idxs)
+ str(data)
+ stopifnot(length(data) == Jall)
+ }
+ message(sprintf("Testing readCdfUnitsWriteMap() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
int [1:15876] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
Testing readCdfUnitsWriteMap() with 'readAll' indices...
List of 1
$ idxs: NULL
int [1:15876] 10066 10192 2414 2540 5010 5136 6949 7075 14264 14390 ...
Testing readCdfUnitsWriteMap() with 'readAll' indices...done
Testing readCdfUnitsWriteMap() with 'readOne' indices...
List of 1
$ idxs: int 10
int [1:15876] 4196 4322 8522 8648 8259 8385 14038 14164 5498 5624 ...
Testing readCdfUnitsWriteMap() with 'readOne' indices...done
Testing readCdfUnitsWriteMap() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
int [1:15876] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
Testing readCdfUnitsWriteMap() with 'readSome' indices...done
Testing readCdfUnitsWriteMap() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
int [1:15876] 5686 5812 7218 7344 7014 7140 2256 2382 8310 8436 ...
Testing readCdfUnitsWriteMap() with 'readDouble' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains non-positive indices: -1"
$ call : language readCdfUnitsWriteMap(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains non-positive indices: 0"
$ call : language readCdfUnitsWriteMap(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains indices out of range [1,345]: 1e+09"
$ call : language readCdfUnitsWriteMap(cdf, units = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCdfUnitsWriteMap() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.136 0.043 0.182
affxparser.Rcheck/tests/readCel.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+
+ # Find all CEL files
+ cels <- list.files(path=pathD, pattern="[.]CEL$",
+ recursive=TRUE, full.names=TRUE)
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ # readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ for (kk in seq_along(cels)) {
+ cel <- cels[kk]
+
+ # Read full file
+ data <- readCel(cel)
+ str(data)
+ Jall <- data$header$total
+ stopifnot(length(data$intensities) == Jall)
+
+ # Read different subsets of cells
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCel() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCel(cel, indices=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCel(cel, indices=idxs)
+ str(data)
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data$intensities) == J)
+ }
+ message(sprintf("Testing readCel() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # for (kk ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num 143
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num 136
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 1
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;GridULX:154.000000;GridULY:164.000000;GridURX:995"| __truncated__
..$ chiptype : chr "Test3"
..$ header : chr ""
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:15876] 190 11263 164 11272 181 ...
$ outliers : int [1:5] 1585 9833 10307 14227 14426
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num 143
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 160\nG"| __truncated__
..$ datheader : chr "[12..40151] Fetal 3:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:28:31 \024 \024 Test3.1sq"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 5
..$ nmasked : int 0
$ intensities: num [1:10] 11053 161 11466 152 11210 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:15876] 164 11900.8 152 11748 80.3 ...
$ outliers : int [1:45] 213 512 809 1344 1372 1603 1687 1690 1953 2204 ...
$ masked : NULL
Testing readCel() with 'readAll' indices...done
Testing readCel() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num 136
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readOne' indices...done
Testing readCel() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readSome' indices...done
Testing readCel() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 4
$ header :List of 14
..$ filename : chr "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
..$ version : int 3
..$ cols : int 126
..$ rows : int 126
..$ total : int 15876
..$ algorithm : chr "Percentile"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004"
..$ chiptype : chr "Test3"
..$ header : chr "Cols=126\nRows=126\nTotalX=126\nTotalY=126\nOffsetX=0\nOffsetY=0\nGridCornerUL=154 164\nGridCornerUR=995 165\nG"| __truncated__
..$ datheader : chr "[6..38103] Fetal 5:CLS=1167 RWS=1167 XIN=3 YIN=3 VE=17 2.0 08/16/01 17:32:06 \024 \024 Test3.1sq "| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 45
..$ nmasked : int 0
$ intensities: num [1:10] 9044 121 10406 180 11062 ...
$ outliers : NULL
$ masked : NULL
Testing readCel() with 'readDouble' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
Testing readCel() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(cel, indices = idxs)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCel() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.389 0.076 0.466
affxparser.Rcheck/tests/readCelIntensities.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+
+ # Find all CEL files
+ path <- file.path(pathD, "2.Calvin")
+ cels <- list.files(path=path, pattern="[.]CEL$", full.names=TRUE)
+
+ hdr <- readCelHeader(cels[1L])
+ I <- length(cels)
+ Jall <- hdr$total
+
+ # Read full file
+ data <- readCelIntensities(cels)
+ str(data)
+ stopifnot(all(dim(data) == c(Jall,I)))
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ # readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read different subsets of cells
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCelIntensities() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCelIntensities(cels, indices=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCelIntensities(cels, indices=idxs)
+ str(data)
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(all(dim(data) == c(J,I)))
+ }
+ message(sprintf("Testing readCelIntensities() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
num [1:15876, 1:2] 190 11263 164 11272 181 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readAll' indices...
List of 1
$ idxs: NULL
num [1:15876, 1:2] 190 11263 164 11272 181 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readAll' indices...done
Testing readCelIntensities() with 'readOne' indices...
List of 1
$ idxs: int 10
num [1, 1:2] 143 136
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readOne' indices...done
Testing readCelIntensities() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
num [1:10, 1:2] 11053 161 11466 152 11210 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readSome' indices...done
Testing readCelIntensities() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
num [1:10, 1:2] 11053 161 11466 152 11210 ...
- attr(*, "dimnames")=List of 2
..$ : NULL
..$ : chr [1:2] "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__ "/Library/Frameworks/R.framework/Versions/4.6/Resources/library/AffymetrixDataTestFiles/rawData/FusionSDK_Test3/"| __truncated__
Testing readCelIntensities() with 'readDouble' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE, readHeader = FALSE, readStdvs = | __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE, readHeader = FALSE, readStdvs = | __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
Testing readCelIntensities() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' is out of range [1,15876]."
$ call : language readCel(filename = filenames[i], indices = indices, readIntensities = TRUE, readHeader = FALSE, readStdvs = | __truncated__ ...
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelIntensities() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.143 0.044 0.181
affxparser.Rcheck/tests/readCelRectangle.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ rotate270 <- function(x, ...) {
+ x <- t(x)
+ nc <- ncol(x)
+ if (nc < 2) return(x)
+ x[,nc:1,drop=FALSE]
+ }
+
+ # Search for some available CEL files
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_HG-Focus", "HG-Focus")
+ cel <- file.path(pathD, "2.Calvin", "HG-Focus-1-121502.CEL")
+
+ # Read CEL intensities in the upper left corner
+ range <- c(0,250)
+ data <- readCelRectangle(cel, xrange=range, yrange=range)
+
+ # Displaying image
+ z <- rotate270(data$intensities)
+ sub <- sprintf("Chip type: %s", data$header$chiptype)
+ image(z, col=gray.colors(256), axes=FALSE, main=basename(cel), sub=sub)
+ text(x=0, y=1, labels="(0,0)", adj=c(0,-0.7), cex=0.8, xpd=TRUE)
+ text(x=1, y=0, labels="(250,250)", adj=c(1,1.2), cex=0.8, xpd=TRUE)
+
+ # Read 1x1 rectangle
+ range <- c(0,0)
+ data <- readCelRectangle(cel, xrange=range, yrange=range)
+ print(data$intensities)
+ stopifnot(all(dim(data$intensities) == c(1,1)))
+ }
Loading required package: AffymetrixDataTestFiles
[,1]
[1,] 83.3
>
>
>
> proc.time()
user system elapsed
0.204 0.050 0.246
affxparser.Rcheck/tests/readCelUnits.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles")) {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "Test3")
+ pathD <- file.path(pathR, "rawData", "FusionSDK_Test3", "Test3")
+
+ # Read CDF structure
+ cdf <- file.path(pathA, "1.XDA", "Test3.CDF")
+ hdr <- readCdfHeader(cdf)
+ Jall <- hdr$nunits
+
+ # Find all CEL files
+ cels <- list.files(path=pathD, pattern="[.]CEL$",
+ recursive=TRUE, full.names=TRUE)
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=10L,
+ readSome=11:20,
+ readDouble=as.double(11:20),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ # Read full file
+ data <- readCelUnits(cels, cdf=cdf)
+ str(head(data))
+ stopifnot(length(data) == Jall)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readCelUnits() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readCelUnits(cels, units=idxs, cdf=cdf), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readCelUnits(cels, units=idxs, cdf=cdf)
+ str(head(data))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data) == J)
+ }
+ message(sprintf("Testing readCelUnits() with '%s' indices...done", name))
+ } # for (ii ...)
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ Pae_16SrRNA_s_at:List of 1
..$ Pae_16SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 181 132 134 159 107 ...
$ Pae_23SrRNA_s_at:List of 1
..$ Pae_23SrRNA_s_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 122 135 93 108 154 ...
$ PA1178_oprH_at :List of 1
..$ PA1178_oprH_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 97 108 126 214 157 ...
$ PA1816_dnaQ_at :List of 1
..$ PA1816_dnaQ_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 117 112 126 132 142 ...
$ PA3183_zwf_at :List of 1
..$ PA3183_zwf_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 264 163 238 466 248 ...
$ PA3640_dnaE_at :List of 1
..$ PA3640_dnaE_at:List of 1
.. ..$ intensities: num [1:24, 1:4] 98 88.5 412 1025 362.3 ...
Testing readCelUnits() with 'readAll' indices...done
Testing readCelUnits() with 'readOne' indices...
List of 1
$ idxs: int 10
List of 1
$ PA1178_oprH_st:List of 1
..$ PA1178_oprH_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 114 119 142 139 170 ...
Testing readCelUnits() with 'readOne' indices...done
Testing readCelUnits() with 'readSome' indices...
List of 1
$ idxs: int [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readSome' indices...done
Testing readCelUnits() with 'readDouble' indices...
List of 1
$ idxs: num [1:10] 11 12 13 14 15 16 17 18 19 20
List of 6
$ PA1816_dnaQ_st :List of 1
..$ PA1816_dnaQ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 114 109 121 114 138 ...
$ PA3183_zwf_st :List of 1
..$ PA3183_zwf_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 143 221 124 137 184 ...
$ PA3640_dnaE_st :List of 1
..$ PA3640_dnaE_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 141 134 181 180 246 ...
$ PA4407_ftsZ_st :List of 1
..$ PA4407_ftsZ_st:List of 1
.. ..$ intensities: num [1:24, 1:4] 180 222 135 129 240 ...
$ AFFX-Athal-Actin_5_r_at:List of 1
..$ AFFX-Athal-Actin_5_r_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 274 170 266 227 314 ...
$ AFFX-Athal-Actin_M_at :List of 1
..$ AFFX-Athal-Actin_M_at:List of 1
.. ..$ intensities: num [1:32, 1:4] 112 178 131 112 144 ...
Testing readCelUnits() with 'readDouble' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'units' contains non-positive indices."
$ call : language readCelUnits(cels, units = idxs, cdf = cdf)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'units' contains non-positive indices."
$ call : language readCelUnits(cels, units = idxs, cdf = cdf)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
Testing readCelUnits() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'units' contains an element out of range: 1000000000"
$ call : language readCdfCellIndices(cdfFile, units = units, stratifyBy = stratifyBy, verbose = FALSE)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readCelUnits() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.211 0.051 0.263
affxparser.Rcheck/tests/readPgf.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> if (require("AffymetrixDataTestFiles") && packageVersion("AffymetrixDataTestFiles") >= "0.4.0") {
+ library("affxparser")
+
+ pathR <- system.file(package="AffymetrixDataTestFiles")
+ pathA <- file.path(pathR, "annotationData", "chipTypes", "HuGene-1_0-st-v1")
+
+ # Read PGF structure
+ pgf <- file.path(pathA, "HuGene-1_0-st-v1.r4,10_probesets.pgf")
+
+ # NOTE: Hard-coded
+ Jall <- 10L
+
+ # Various sets of indices to be read
+ idxsList <- list(
+ ## readNothing=integer(0L), # FIX ME
+ readAll=NULL,
+ readOne=5L,
+ readSome=1:5,
+ readDouble=as.double(1:5),
+ outOfRange=-1L,
+ outOfRange=0L,
+ outOfRange=1e9L
+ )
+
+ data <- readPgf(pgf)
+ str(head(data))
+ stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+ stopifnot(length(data$probesetName) == Jall)
+
+ # Read different subsets of units
+ for (ii in seq_along(idxsList)) {
+ name <- names(idxsList)[ii]
+ message(sprintf("Testing readPgf() with '%s' indices...", name))
+ idxs <- idxsList[[ii]]
+ str(list(idxs=idxs))
+ if (grepl("outOfRange", name)) {
+ res <- tryCatch(readPgf(pgf, indices=idxs), error=function(ex) ex)
+ str(res)
+ stopifnot(inherits(res, "error"))
+ } else {
+ data <- readPgf(pgf, indices=idxs)
+ str(head(data))
+ stopifnot(identical(data$header$chip_type, "HuGene-1_0-st-v1"))
+ J <- if (is.null(idxs)) Jall else length(idxs)
+ stopifnot(length(data$probesetName) == J)
+ }
+ message(sprintf("Testing readPgf() with '%s' indices...done", name))
+ } # for (ii ...)
+
+
+ # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+ # Validate correctness of subsets
+ # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+ subsetPgf <- function(data, indices=NULL, ...) {
+ if (is.null(indices)) return(data)
+
+ # Atoms
+ offsets <- data$probesetStartAtom
+ natoms <- diff(c(offsets, length(data0$atomStartProbe)+1L))
+ offsets <- offsets[indices]
+ natoms <- natoms[indices]
+ # Identify atoms to keep
+ keep <- logical(length(data$atomStartProbe))
+ for (kk in seq_along(offsets)) {
+ keep[seq(from=offsets[kk], by=1L, length=natoms[kk])] <- TRUE;
+ }
+
+ for (ff in c("probeSequence", "probeId", "probeGcCount", "atomExonPosition", "atomId", "probeInterrogationPosition", "probeLength", "probeType")) {
+ data[[ff]] <- data[[ff]][keep]
+ }
+
+ data$atomStartProbe <- seq_len(sum(natoms))
+ data$probesetStartAtom <- c(1L, cumsum(natoms))[length(indices)]
+
+ # Probesets
+ for (ff in c("probesetName", "probesetId", "probesetType")) {
+ data[[ff]] <- data[[ff]][indices]
+ }
+
+ data
+ } # subsetPgf()
+
+ data0 <- readPgf(pgf)
+ Jall <- length(data0$probesetId)
+
+ for (kk in 1:10) {
+ n <- sample(Jall, size=1L)
+ idxs <- sort(sample(1:Jall, size=n, replace=FALSE))
+ data <- readPgf(pgf, indices=idxs)
+ dataS <- subsetPgf(data0, indices=idxs)
+ for (ff in c("probesetStartAtom", "atomExonPosition"))
+ data[[ff]] <- dataS[[ff]] <- NULL
+ stopifnot(all.equal(data, dataS))
+ }
+ } # if (require("AffymetrixDataTestFiles"))
Loading required package: AffymetrixDataTestFiles
List of 6
$ probeSequence : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:10] "" "" "" "" ...
$ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
$ probeId : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
$ probesetType : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...
List of 1
$ idxs: NULL
List of 6
$ probeSequence : chr [1:40] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:10] "" "" "" "" ...
$ probesetStartAtom: int [1:10] 1 5 9 13 17 21 25 29 33 37
$ probeId : int [1:40] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:10] 7892501 7892502 7892503 7892504 7892505 7892506 7892507 7892508 7892509 7892510
$ probesetType : chr [1:10] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readAll' indices...done
Testing readPgf() with 'readOne' indices...
List of 1
$ idxs: int 5
List of 6
$ probeSequence : chr [1:4] "AGATGTGTATAGAGGGTTTAACTTA" "TGTGTATAGAGGGTTTAACTTAAAT" "GTGTATAGAGGGTTTAACTTAAATA" "GATGTGTATAGAGGGTTTAACTTAA"
$ probesetName : chr ""
$ probesetStartAtom: int 1
$ probeId : int [1:4] 611456 834021 857576 980218
$ probesetId : int 7892505
$ probesetType : chr "normgene->intron"
Testing readPgf() with 'readOne' indices...done
Testing readPgf() with 'readSome' indices...
List of 1
$ idxs: int [1:5] 1 2 3 4 5
List of 6
$ probeSequence : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:5] "" "" "" "" ...
$ probesetStartAtom: int [1:5] 1 5 9 13 17
$ probeId : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:5] 7892501 7892502 7892503 7892504 7892505
$ probesetType : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readSome' indices...done
Testing readPgf() with 'readDouble' indices...
List of 1
$ idxs: num [1:5] 1 2 3 4 5
List of 6
$ probeSequence : chr [1:20] "AAGCTTAGTAGACTATAAATATGAC" "GCTTAGTAGACTATAAATATGACTT" "GTAGACTATAAATATGACTTACTCA" "ACTATAAATATGACTTACTCAATGA" ...
$ probesetName : chr [1:5] "" "" "" "" ...
$ probesetStartAtom: int [1:5] 1 5 9 13 17
$ probeId : int [1:20] 116371 943979 493089 907039 1033309 653512 690769 997409 379979 469846 ...
$ probesetId : int [1:5] 7892501 7892502 7892503 7892504 7892505
$ probesetType : chr [1:5] "normgene->exon" "normgene->intron" "normgene->intron" "normgene->intron" ...
Testing readPgf() with 'readDouble' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
$ idxs: int -1
List of 2
$ message: chr "Argument 'indices' contains a non-positive element"
$ call : language readPgfEnv(file, readBody = TRUE, indices = indices)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
$ idxs: int 0
List of 2
$ message: chr "Argument 'indices' contains a non-positive element"
$ call : language readPgfEnv(file, readBody = TRUE, indices = indices)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
Testing readPgf() with 'outOfRange' indices...
List of 1
$ idxs: int 1000000000
List of 2
$ message: chr "Argument 'indices' contains an element out of range [1,10]: 1000000000"
$ call : language readPgfEnv(file, readBody = TRUE, indices = indices)
- attr(*, "class")= chr [1:3] "simpleError" "error" "condition"
Testing readPgf() with 'outOfRange' indices...done
>
> proc.time()
user system elapsed
0.149 0.047 0.188
affxparser.Rcheck/tests/testWriteAndReadEmptyCdf.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> systemR <- function(command="", ..., verbose=FALSE) {
+ # Locate the R executable
+ Rbin <- file.path(R.home("bin"), "R")
+ cmd <- sprintf('%s %s', shQuote(Rbin), command)
+ if (verbose) cat("Command: ", cmd, "\n", sep="")
+ system(cmd, ...)
+ } # systemR()
>
>
> ## Explicitly append 'affxparser' to library path
> ## Needed for covr::coverage()
> pd <- packageDescription("affxparser")
> libpath <- dirname(dirname(dirname(attr(pd, "file"))))
> cmd <- sprintf(' -e ".libPaths(\'%s\'); affxparser:::.testWriteAndReadEmptyCdf()"', libpath)
> out <- systemR(cmd, intern=TRUE, wait=TRUE, verbose=TRUE)
Command: '/Library/Frameworks/R.framework/Resources/bin/R' -e ".libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpIN9A4Q/RLIBS_7da5cf676c1'); affxparser:::.testWriteAndReadEmptyCdf()"
> cat(out, sep="\n")
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> .libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpIN9A4Q/RLIBS_7da5cf676c1'); affxparser:::.testWriteAndReadEmptyCdf()
Pathname: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/affxparser/testscripts/writeAndReadEmptyCdf.R
> library("affxparser")
> hdr <- list(chiptype = "Empty2x3", nrows = 2, ncols = 3,
+ nunits = 0, nqcunits = 0, refseq = "")
> units <- qcUnits <- list()
> pathname <- file.path(tempdir(), "Empty2x3.cdf")
> str(pathname)
chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpIIkd5Z/Empty2x3.cdf"
> writeCdf(pathname, cdfheader = hdr, cdf = units, cdfqc = qcUnits,
+ overwrite = TRUE)
> hdr2 <- readCdfHeader(pathname)
> str(hdr2)
List of 12
$ ncols : int 3
$ nrows : int 2
$ nunits : int 0
$ nqcunits : int 0
$ refseq : chr ""
$ chiptype : chr "Empty2x3"
$ filename : chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpIIkd5Z/Empty2x3.cdf"
$ rows : int 2
$ cols : int 3
$ probesets : int 0
$ qcprobesets: int 0
$ reference : chr ""
> units2 <- readCdfUnits(pathname)
> str(units2)
Named list()
COMPLETE
>
> res <- any(regexpr("COMPLETE", out) != -1)
> cat("Test result: ", res, "\n", sep="")
Test result: TRUE
> if (!res) {
+ stop("affxparser:::.testWriteAndReadEmptyCdf() failed.")
+ }
>
> ############################################################################
> # HISTORY:
> # 2012-05-22
> # o ROBUSTNESS: Now launching R without assuming it is on the search path,
> # cf. R-devel thread 'Best way to locate R executable from within R?'
> # on May 22, 2012.
> # 2012-05-18
> # o Added because of the OSX build bug, cf.
> # https://groups.google.com/d/topic/aroma-affymetrix/lEfDanThLEA/discussion
> # o Created.
> ############################################################################
>
> proc.time()
user system elapsed
0.216 0.091 0.345
affxparser.Rcheck/tests/testWriteAndReadEmptyCel.Rout
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> systemR <- function(command="", ..., verbose=FALSE) {
+ # Locate the R executable
+ Rbin <- file.path(R.home("bin"), "R")
+ cmd <- sprintf('%s %s', shQuote(Rbin), command)
+ if (verbose) cat("Command: ", cmd, "\n", sep="")
+ system(cmd, ...)
+ } # systemR()
>
>
> ## Explicitly append 'affxparser' to library path
> ## Needed for covr::coverage()
> pd <- packageDescription("affxparser")
> libpath <- dirname(dirname(dirname(attr(pd, "file"))))
> cmd <- sprintf(' -e ".libPaths(\'%s\'); affxparser:::.testWriteAndReadEmptyCel()"', libpath)
> out <- systemR(cmd, intern=TRUE, wait=TRUE, verbose=TRUE)
Command: '/Library/Frameworks/R.framework/Resources/bin/R' -e ".libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpIN9A4Q/RLIBS_7da5cf676c1'); affxparser:::.testWriteAndReadEmptyCel()"
> cat(out, sep="\n")
R version 4.6.0 alpha (2026-03-28 r89739)
Copyright (C) 2026 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin23
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> .libPaths('/private/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T/RtmpIN9A4Q/RLIBS_7da5cf676c1'); affxparser:::.testWriteAndReadEmptyCel()
Pathname: /Library/Frameworks/R.framework/Versions/4.6/Resources/library/affxparser/testscripts/writeAndReadEmptyCel.R
> library("affxparser")
> hdr <- list(version = 4, chiptype = "Empty2x3", rows = 2,
+ cols = 3, algorithm = "Percentile\nAlgorithm", parameters = "Percentile:75;CellMarg ..." ... [TRUNCATED]
> hdr$header <- sprintf("Cols=%d\nRows=%d\nTotalX=%d\nTotalY=%d\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCornerLR=3565 ..." ... [TRUNCATED]
> pathname <- file.path(tempdir(), "Empty2x3.cel")
> str(pathname)
chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpAlQbd2/Empty2x3.cel"
> createCel(pathname, header = hdr, overwrite = TRUE)
> hdr2 <- readCelHeader(pathname)
> str(hdr2)
List of 14
$ filename : chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpAlQbd2/Empty2x3.cel"
$ version : int 4
$ cols : int 3
$ rows : int 2
$ total : int 6
$ algorithm : chr "Percentile\nAlgorithm"
$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:TRUE;FullFeatureWidt"| __truncated__
$ chiptype : chr "Empty2x3"
$ header : chr "Cols=3\nRows=2\nTotalX=3\nTotalY=2\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCorn"| __truncated__
$ datheader : chr "[13..25244] 050523MJA_SNP10K-2.0_KJ05:CLS=3666 RWS=3666 XIN=1 YIN=1 VE=30 2.0 09/26/12 10:01:02 50102"| __truncated__
$ librarypackage: chr ""
$ cellmargin : int 2
$ noutliers : int 0
$ nmasked : int 0
> data2 <- readCel(pathname)
> str(data2)
List of 4
$ header :List of 14
..$ filename : chr "/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//RtmpAlQbd2/Empty2x3.cel"
..$ version : int 4
..$ cols : int 3
..$ rows : int 2
..$ total : int 6
..$ algorithm : chr "Percentile\nAlgorithm"
..$ parameters : chr "Percentile:75;CellMargin:2;OutlierHigh:1.500;OutlierLow:1.004;AlgVersion:6.0;FixedCellSize:TRUE;FullFeatureWidt"| __truncated__
..$ chiptype : chr "Empty2x3"
..$ header : chr "Cols=3\nRows=2\nTotalX=3\nTotalY=2\nOffsetX=0\nOffsetY=0\nGridCornerUL=223 141\nGridCornerUR=3590 166\nGridCorn"| __truncated__
..$ datheader : chr "[13..25244] 050523MJA_SNP10K-2.0_KJ05:CLS=3666 RWS=3666 XIN=1 YIN=1 VE=30 2.0 09/26/12 10:01:02 50102"| __truncated__
..$ librarypackage: chr ""
..$ cellmargin : int 2
..$ noutliers : int 0
..$ nmasked : int 0
$ intensities: num [1:6] 0 0 0 0 0 0
$ outliers : NULL
$ masked : NULL
COMPLETE
>
> res <- any(regexpr("COMPLETE", out) != -1)
> cat("Test result: ", res, "\n", sep="")
Test result: TRUE
> if (!res) {
+ stop("affxparser:::.testWriteAndReadEmptyCel() failed.")
+ }
>
> ############################################################################
> # HISTORY:
> # 2012-09-26
> # o Created from tests/testWriteAndReadEmptyCdf.R.
> ############################################################################
>
> proc.time()
user system elapsed
0.181 0.069 0.268
affxparser.Rcheck/affxparser-Ex.timings
| name | user | system | elapsed | |
| applyCdfGroups | 0.026 | 0.027 | 0.057 | |
| convertCdf | 0.241 | 0.010 | 0.253 | |
| convertCel | 0.035 | 0.006 | 0.044 | |
| createCel | 0.068 | 0.007 | 0.082 | |
| findCdf | 0.018 | 0.004 | 0.023 | |
| invertMap | 0.206 | 0.003 | 0.210 | |
| readCdfDataFrame | 0.267 | 0.012 | 0.282 | |
| readCdfHeader | 0.002 | 0.001 | 0.003 | |
| readCdfNbrOfCellsPerUnitGroup | 0.165 | 0.103 | 0.309 | |
| readCdfUnitNames | 0 | 0 | 0 | |
| readCdfUnits | 0.519 | 0.020 | 0.551 | |
| readCdfUnitsWriteMap | 0.201 | 0.010 | 0.210 | |
| readCel | 0.002 | 0.000 | 0.003 | |
| readCelHeader | 0 | 0 | 0 | |
| readCelIntensities | 0.000 | 0.001 | 0.000 | |
| readCelRectangle | 0.111 | 0.016 | 0.136 | |
| readCelUnits | 0.004 | 0.001 | 0.005 | |
| readChp | 0.006 | 0.002 | 0.009 | |
| updateCel | 0.339 | 0.053 | 0.416 | |
| updateCelUnits | 0.589 | 0.089 | 0.702 | |