Changqing Wang
| Snapshot Date: 2025-10-13 13:40 -0400 (Mon, 13 Oct 2025) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: RELEASE_3_21 |
| git_last_commit: 273f0f6 |
| git_last_commit_date: 2025-04-15 12:35:03 -0400 (Tue, 15 Apr 2025) |
| Back to Multiple platform build/check report for BioC 3.21: simplified long |
|
This page was generated on 2025-10-16 11:40 -0400 (Thu, 16 Oct 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.5.1 (2025-06-13) -- "Great Square Root" | 4833 |
| merida1 | macOS 12.7.6 Monterey | x86_64 | 4.5.1 RC (2025-06-05 r88288) -- "Great Square Root" | 4614 |
| kjohnson1 | macOS 13.7.5 Ventura | arm64 | 4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root" | 4555 |
| kunpeng2 | Linux (openEuler 24.03 LTS) | aarch64 | R Under development (unstable) (2025-02-19 r87757) -- "Unsuffered Consequences" | 4586 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 735/2341 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 2.2.0 (landing page) Changqing Wang
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | OK | | ||||||||
| merida1 | macOS 12.7.6 Monterey / x86_64 | OK | OK | OK | OK | | ||||||||
| kjohnson1 | macOS 13.7.5 Ventura / arm64 | OK | OK | OK | OK | | ||||||||
| kunpeng2 | Linux (openEuler 24.03 LTS) / aarch64 | OK | OK | ERROR | ||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 2.2.0 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz |
| StartedAt: 2025-10-14 21:41:55 -0400 (Tue, 14 Oct 2025) |
| EndedAt: 2025-10-14 21:53:26 -0400 (Tue, 14 Oct 2025) |
| EllapsedTime: 691.3 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.2.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.1 Patched (2025-06-14 r88325)
* using platform: aarch64-apple-darwin20
* R was compiled by
Apple clang version 16.0.0 (clang-1600.0.26.6)
GNU Fortran (GCC) 14.2.0
* running under: macOS Ventura 13.7.5
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.2.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 46 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable. Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
installed size is 5.4Mb
sub-directories of 1Mb or more:
data 2.7Mb
libs 1.6Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
addRowRanges: no visible global function definition for ‘head’
chisq_test_by_gene: no visible global function definition for
‘chisq.test’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
filter_coverage: no visible global function definition for
‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_barcode: no visible binding for global variable ‘Sample’
find_barcode: no visible binding for global variable ‘Outfile’
find_variants_grange: no visible binding for global variable
‘which_label’
find_variants_grange: no visible binding for global variable
‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex: no visible binding for global variable ‘CellBarcode’
plot_demultiplex: no visible binding for global variable ‘Sample’
plot_demultiplex: no visible binding for global variable ‘UMI’
plot_demultiplex: no visible binding for global variable ‘UMI_count’
plot_demultiplex: no visible binding for global variable ‘barcode_rank’
plot_demultiplex: no visible binding for global variable
‘FlankEditDist’
plot_demultiplex: no visible binding for global variable ‘n_reads’
plot_demultiplex: no visible binding for global variable
‘BarcodeEditDist’
plot_demultiplex: no visible binding for global variable ‘total reads’
plot_demultiplex: no visible binding for global variable ‘demultiplexed
reads’
plot_demultiplex: no visible binding for global variable ‘single match
reads’
plot_demultiplex: no visible binding for global variable
‘undemultiplexted reads’
plot_demultiplex: no visible binding for global variable
‘multi-matching reads’
plot_demultiplex: no visible binding for global variable ‘Type’
plot_demultiplex: no visible binding for global variable ‘Reads’
plot_demultiplex: no visible binding for global variable ‘input’
plot_demultiplex: no visible binding for global variable ‘output’
plot_demultiplex: no visible binding for global variable
‘read1_with_adapter’
plot_demultiplex: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_transcript_usage_chisq: no visible binding for global variable
‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘total’
sc_transcript_usage_permutation: no visible binding for global variable
‘test’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
‘cell_total_reads’
Undefined global functions or variables:
BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count
bam_index barcode barcode_rank cell_total_reads chisq.test count
counts_no_ins cumpct demultiplexed reads everything expr filter_res
head imageX imageY in_tissue input length_bin max_length min_length
multi-matching reads mutation_index n_reads na.omit name nucleotide
output p.value pct pos read1_with_adapter read_counts ref
scale_alpha_continuous scale_colour_gradient single match reads
starts_with test total total reads total_counts tr_length transcript
undemultiplexted reads value which_label x y
Consider adding
importFrom("base", "match", "single")
importFrom("stats", "chisq.test", "na.omit")
importFrom("utils", "head")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... NOTE
Found the following Rd file(s) with Rd \link{} targets missing package
anchors:
bulk_long_pipeline.Rd: SummarizedExperiment
sc_long_multisample_pipeline.Rd: SingleCellExperiment
sc_long_pipeline.Rd: SingleCellExperiment
Please provide package anchors for all Rd \link{} targets not in the
package itself and the base packages.
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs/FLAMES.so’:
Found ‘___assert_rtn’, possibly from ‘assert’ (C)
Found ‘___stderrp’, possibly from ‘stderr’ (C)
Found ‘___stdoutp’, possibly from ‘stdout’ (C)
Found ‘_abort’, possibly from ‘abort’ (C)
Found ‘_exit’, possibly from ‘exit’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
bulk_long_pipeline 31.691 2.560 33.981
plot_isoform_reduced_dim 28.467 0.322 28.919
create_se_from_dir 26.254 0.818 24.210
sc_long_multisample_pipeline 22.107 3.099 20.852
sc_DTU_analysis 11.954 1.686 11.980
get_GRangesList 9.852 0.269 10.250
create_sce_from_dir 8.106 1.959 11.512
plot_isoform_heatmap 9.615 0.307 9.953
find_isoform 9.624 0.242 10.232
plot_coverage 8.451 0.266 8.842
minimap2_align 8.188 0.238 8.735
sc_long_pipeline 6.519 1.071 5.695
filter_coverage 5.611 0.273 6.643
get_coverage 5.626 0.225 5.924
find_variants 4.621 0.408 5.251
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 4 NOTEs
See
‘/Users/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.2.0’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.0.40.1)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
unsigned int end;
^
1 warning generated.
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch arm64 -std=gnu2x -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
ld: warning: ignoring duplicate libraries: '-lz'
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /tmp/RtmpiymqvG/file1595e5d9fedc0/config_file_88414.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595e4a5acd2c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595eada8eb8/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595eada8eb8/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiymqvG/file1595eb538775/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595e33f59605/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595e33f59605/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpiymqvG/file1595e4d3305f9/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595e33f59605/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpiymqvG/file1595e6becaaab/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
>
> proc.time()
user system elapsed
24.080 1.361 28.382
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| add_gene_counts | 0.517 | 0.007 | 0.538 | |
| annotation_to_fasta | 1.540 | 0.030 | 1.593 | |
| blaze | 0.322 | 0.056 | 1.987 | |
| bulk_long_pipeline | 31.691 | 2.560 | 33.981 | |
| combine_sce | 0.716 | 0.012 | 0.734 | |
| convolution_filter | 0.000 | 0.000 | 0.001 | |
| create_config | 0.005 | 0.001 | 0.008 | |
| create_sce_from_dir | 8.106 | 1.959 | 11.512 | |
| create_se_from_dir | 26.254 | 0.818 | 24.210 | |
| cutadapt | 0.114 | 0.046 | 0.169 | |
| filter_annotation | 0.544 | 0.083 | 0.690 | |
| filter_coverage | 5.611 | 0.273 | 6.643 | |
| find_barcode | 1.116 | 0.276 | 1.545 | |
| find_bin | 0.011 | 0.014 | 0.037 | |
| find_isoform | 9.624 | 0.242 | 10.232 | |
| find_variants | 4.621 | 0.408 | 5.251 | |
| get_GRangesList | 9.852 | 0.269 | 10.250 | |
| get_coverage | 5.626 | 0.225 | 5.924 | |
| minimap2_align | 8.188 | 0.238 | 8.735 | |
| minimap2_realign | 0.810 | 0.103 | 0.935 | |
| mutation_positions | 1.956 | 0.025 | 2.000 | |
| plot_coverage | 8.451 | 0.266 | 8.842 | |
| plot_demultiplex | 1.973 | 0.130 | 2.132 | |
| plot_isoform_heatmap | 9.615 | 0.307 | 9.953 | |
| plot_isoform_reduced_dim | 28.467 | 0.322 | 28.919 | |
| plot_isoforms | 3.434 | 0.015 | 3.459 | |
| quantify_transcript | 2.363 | 0.085 | 2.483 | |
| quantify_transcript_flames | 1.913 | 0.076 | 2.039 | |
| sc_DTU_analysis | 11.954 | 1.686 | 11.980 | |
| sc_impute_transcript | 0.573 | 0.009 | 0.582 | |
| sc_long_multisample_pipeline | 22.107 | 3.099 | 20.852 | |
| sc_long_pipeline | 6.519 | 1.071 | 5.695 | |
| sc_mutations | 2.451 | 0.447 | 3.089 | |
| weight_transcripts | 0.025 | 0.022 | 0.051 | |