Back to Multiple platform build/check report for BioC 3.20: simplified long |
|
This page was generated on 2024-09-17 11:39 -0400 (Tue, 17 Sep 2024).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
teran2 | Linux (Ubuntu 24.04.1 LTS) | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4445 |
palomino8 | Windows Server 2022 Datacenter | x64 | 4.4.1 (2024-06-14 ucrt) -- "Race for Your Life" | 4450 |
lconway | macOS 12.7.1 Monterey | x86_64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4483 |
kjohnson3 | macOS 13.6.5 Ventura | arm64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4430 |
kunpeng2 | Linux (openEuler 22.03 LTS-SP1) | aarch64 | 4.4.1 (2024-06-14) -- "Race for Your Life" | 4428 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 713/2258 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 1.11.1 (landing page) Changqing Wang
| teran2 | Linux (Ubuntu 24.04.1 LTS) / x86_64 | OK | OK | OK | |||||||||
palomino8 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | |||||||||
kjohnson3 | macOS 13.6.5 Ventura / arm64 | OK | OK | OK | OK | |||||||||
kunpeng2 | Linux (openEuler 22.03 LTS-SP1) / aarch64 | OK | OK | OK | ||||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 1.11.1 |
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.11.1.tar.gz |
StartedAt: 2024-09-16 20:39:41 -0400 (Mon, 16 Sep 2024) |
EndedAt: 2024-09-16 20:50:37 -0400 (Mon, 16 Sep 2024) |
EllapsedTime: 656.1 seconds |
RetCode: 0 |
Status: OK |
CheckDir: FLAMES.Rcheck |
Warnings: 0 |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.11.1.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck’ * using R version 4.4.1 (2024-06-14) * using platform: x86_64-apple-darwin20 * R was compiled by Apple clang version 14.0.0 (clang-1400.0.29.202) GNU Fortran (GCC) 12.2.0 * running under: macOS Monterey 12.7.1 * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * this is package ‘FLAMES’ version ‘1.11.1’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/Users/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ * used SDK: ‘MacOSX11.3.sdk’ * checking C++ specification ... OK Not all R platforms support C++17 * checking installed package size ... NOTE installed size is 5.4Mb sub-directories of 1Mb or more: data 2.7Mb libs 1.6Mb * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... NOTE Namespace in Imports field not imported from: 'IRanges' All declared Imports should be used. * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE find_variants_grange: no visible binding for global variable 'which_label' find_variants_grange: no visible binding for global variable 'nucleotide' find_variants_grange: no visible binding for global variable 'pos' find_variants_grange: no visible binding for global variable 'count' find_variants_grange: no visible binding for global variable 'counts_no_ins' find_variants_grange: no visible binding for global variable 'ref' generate_sc_sce: no visible binding for global variable 'FSM_match' homopolymer_pct : <anonymous>: no visible binding for global variable 'Freq' homopolymer_pct : <anonymous>: no visible binding for global variable 'pct' plot_coverage: no visible binding for global variable 'x' plot_coverage: no visible binding for global variable 'transcript' plot_coverage: no visible binding for global variable 'length_bin' plot_demultiplex: no visible binding for global variable 'Freq' plot_demultiplex: no visible binding for global variable '.' plot_demultiplex: no visible binding for global variable 'x' plot_demultiplex: no visible binding for global variable 'FlankEditDist' plot_demultiplex: no visible binding for global variable 'n' plot_demultiplex: no visible binding for global variable 'BarcodeEditDist' plot_flagstat: no visible global function definition for 'everything' plot_flagstat: no visible binding for global variable 'name' plot_flagstat: no visible binding for global variable 'value' sc_DTU_analysis: no visible binding for global variable 'FSM_match' sc_DTU_analysis: no visible binding for global variable 'gene_id' sc_DTU_analysis: no visible binding for global variable '.' sc_DTU_analysis: no visible binding for global variable 'cell_id' sc_DTU_analysis: no visible binding for global variable 'cnt' sc_DTU_analysis: no visible binding for global variable 'tr_id' sc_DTU_analysis: no visible binding for global variable 'label' sc_DTU_analysis : filter_tr: no visible binding for global variable 'gene_id' sc_DTU_analysis : filter_tr: no visible global function definition for 'all_vars' sc_DTU_analysis : filter_tr: no visible binding for global variable '.' sc_DTU_analysis: no visible global function definition for 'all_vars' sc_heatmap_expression: no visible binding for global variable 'transcript_id' sc_heatmap_expression: no visible binding for global variable 'gene_id' sc_heatmap_expression : group_annotation: no visible binding for global variable 'heatmap_annotation_colors' sc_mutations: no visible binding for global variable 'mutation_index' sc_mutations: no visible binding for global variable 'bam_index' sc_umap_expression: no visible binding for global variable 'transcript_id' sc_umap_expression: no visible binding for global variable 'gene_id' sc_umap_expression: no visible binding for global variable 'x' sc_umap_expression: no visible binding for global variable 'y' sc_umap_expression : plot_idx: no visible binding for global variable 'x' sc_umap_expression : plot_idx: no visible binding for global variable 'y' transcript_coverage: no visible binding for global variable 'mat' variant_count_tb: no visible binding for global variable 'barcode' variant_count_tb: no visible binding for global variable 'allele_count' variant_count_tb: no visible binding for global variable 'cell_total_reads' Undefined global functions or variables: . BarcodeEditDist FSM_match FlankEditDist Freq all_vars allele_count bam_index barcode cell_id cell_total_reads cnt count counts_no_ins everything gene_id heatmap_annotation_colors label length_bin mat mutation_index n name nucleotide pct pos ref tr_id transcript transcript_id value which_label x y * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/FLAMES/libs/FLAMES.so’: Found ‘___assert_rtn’, possibly from ‘assert’ (C) Found ‘___stderrp’, possibly from ‘stderr’ (C) Found ‘___stdoutp’, possibly from ‘stdout’ (C) Found ‘_abort’, possibly from ‘abort’ (C) Found ‘_exit’, possibly from ‘exit’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed sc_heatmap_expression 41.720 0.710 41.595 sc_umap_expression 34.387 0.555 34.177 sc_reduce_dims 20.858 0.362 20.324 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 6 NOTEs See ‘/Users/biocbuild/bbs-3.20-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ using C++17 using SDK: ‘MacOSX11.3.sdk’ clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices *** copying figures ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.4.1 (2024-06-14) -- "Race for Your Life" Copyright (C) 2024 The R Foundation for Statistical Computing Platform: x86_64-apple-darwin20 R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > # This file is part of the standard setup for testthat. > # It is recommended that you do not modify it. > # > # Where should you do additional test configuration? > # Learn more about the roles of various files in: > # * https://r-pkgs.org/tests.html > # * https://testthat.r-lib.org/reference/test_package.html#special-files > > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/RtmplKnRg6/file6c962aac3051/config_file_27798.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmplKnRg6/bc_allow.tsv Number of known barcodes: 143 Searching for barcodes... Number of reads processed: 393 Number of reads where a barcode was found: 368 Number of reads where more than one barcode was found: 4 All done! Skipping TSO trimming... [ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ] > > proc.time() user system elapsed 24.819 1.599 26.697
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
annotation_to_fasta | 1.542 | 0.072 | 1.626 | |
blaze | 0.370 | 0.103 | 2.195 | |
bulk_long_pipeline | 1.144 | 0.211 | 2.185 | |
combine_sce | 2.230 | 0.122 | 2.374 | |
create_config | 0.009 | 0.002 | 0.012 | |
create_sce_from_dir | 0.201 | 0.034 | 0.275 | |
create_se_from_dir | 0.941 | 0.183 | 1.416 | |
cutadapt | 0.001 | 0.000 | 0.000 | |
filter_annotation | 0.921 | 0.012 | 0.941 | |
find_barcode | 0.153 | 0.015 | 0.172 | |
find_isoform | 0.925 | 0.120 | 1.209 | |
find_variants | 0.117 | 0.035 | 0.477 | |
get_GRangesList | 1.125 | 0.121 | 1.409 | |
minimap2_align | 0.820 | 0.115 | 1.112 | |
minimap2_realign | 0.986 | 0.118 | 1.282 | |
parse_gff_tree | 0.482 | 0.033 | 0.538 | |
plot_coverage | 1.668 | 0.114 | 1.961 | |
plot_demultiplex | 0.591 | 0.053 | 0.654 | |
quantify_transcript | 4.118 | 0.120 | 4.400 | |
sc_DTU_analysis | 0.161 | 0.030 | 0.219 | |
sc_heatmap_expression | 41.720 | 0.710 | 41.595 | |
sc_long_multisample_pipeline | 1.622 | 0.152 | 1.819 | |
sc_long_pipeline | 0.194 | 0.030 | 0.254 | |
sc_mutations | 0.112 | 0.031 | 0.279 | |
sc_reduce_dims | 20.858 | 0.362 | 20.324 | |
sc_umap_expression | 34.387 | 0.555 | 34.177 | |
sys_which | 0.005 | 0.009 | 0.030 | |