\name{WriteFasta}
\alias{writeFasta}
\alias{strWriteFasta}
\title{Write sequences into fasta file format}
\description{
  Write one or more parts of sequences into Fasta file format.
}
\usage{

writeFasta(file ="data.fasta",seqno = 0, from = getBegSeq(seqno),
                 to = getEndSeq(seqno), name = getAccn(seqno),
                 comment = paste("from", from, "to", to),
                 cpl = 60, append = FALSE)
strWriteFasta(s,file="data.fasta", name="Seq_R",
              comment=as.character(nchar(s)),
              cpl=60,append = FALSE)

}
\arguments{
  \item{seqno}{Integer, number of the sequence. (bufseq)}
  \item{s}{A character string containing the sequence}
  \item{from,to}{Begining and ending of sub-sequences to extract. Can be
    vectors. 0 represent the last nucleotide and 1 the first one.
  }
 \item{name}{Sequence name.}
 \item{comment}{Comment.}
 \item{file}{Output File.}
 \item{cpl}{Number of caracteres by line.}
 \item{append}{Scalar boolean. TRUE -> sequence is added at the end
   of the file. FALSE -> file is written over.}
}
\value{
1 or -1 if error.
}
\author{L.Cottret}
%\seealso{\code{\link{fasta.readSeq}}}

\keyword{utilities}


\examples{

s<-"cgtagctagctagctagctagctacgtagctagctgactgtcgat"
placeString(s)
from <- c(1,14)
to <- c(10,0)
writeFasta(file="bank.fasta",from =from, to=to, append=FALSE)


strWriteFasta(s="ATGTCGTGGTaaattaatTTGGTCCC",file="bank.fasta",append=TRUE)

## Show file
cat(paste(readLines("bank.fasta"),collapse='\n'))


}