\name{Translate}
\alias{translate}
\alias{strTranslate}
\alias{showTable}

\title{Translation from DNA trinucleotides to proteine}
\description{Translation tools from DNA trinucleotides to proteine}

\usage{
translate (seqno, from = 1, to = 0, strand = 0, code = 0,
charcode = "") 
strTranslate (s, code = 0, charcode = "") 
showTable (code = 0, charcode = "") 
}

\arguments{
  \item{seqno}{Integer, sequence number (bufno)}
  \item{s}{Sequence as a character string}
  \item{from,to}{Begining and ending of sequence, can be
    vectors. 0 represent the last nucleotide and 1 the first one.
  }
  \item{strand}{0: forward, 1: reverse, can be a vector}
  \item{code}{One of the following standard code:
  \code{0}, standard genetic code;
  \code{1} Vertebrate Mitochondrial Code;
  \code{2} Yeast Mitochondrial Code;
  \code{3} Mold, Protozoan, and Coelenterate Mitochondrial Code 
  and the Mycoplasma/Spiroplasma Code;
  \code{4} Invertebrate Mitochondrial Code}
  \item{charcode}{A character string of
    size 64, like
    "FFLLSSSSYY**CC*WLLLL\-PPPPHH\-Q\-QRRRRII\-IMTTTTNNKKSS\-RRVVVVAAAADDEEGGGG"
    for translation code to use, in the order: TTT TTC TTA TTG TCT TCC
    TCA \dots (for F F L L S S S). Use showTable to be sure!
  }
  
}

\value{
  \item{strTranslate}{return a character string of the protein}
  \item{translate}{return a vector of character string of the protein}
  \item{showTable}{return the table of translation}
  All return -1 if error.
  }

\note{Global value of strand  has no effect
on this function. (see \code{\link{globals}}, \code{\link{getParam}}, \code{\link{setStrand}})}

\keyword{utilities}

%\seealso{\code{\link{multiExtract}}}


\examples{
s<-"gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa"

# Simple usage:
strTranslate(s)
#[1] "VMHAR*QLKCV*VTV*Q"


# with buffers
placeString(s)
translate()
# the same...
#[1] "VMHAR*QLKCV*VTV*Q"

# with 2 positions
translate (from=c(1,2),to=c(0,0))
#[1] "VMHAR*QLKCV*VTV*Q" "SCMLGDS*NASR*QSN" 

# with 2 strands
translate (from=c(1,2,1),to=c(0,0,0),strand=c(0,0,1))
#[1] "VMHAR*QLKCV*VTV*Q" "SCMLGDS*NASR*QSN"  "LLDCHLDAF*LSPSMHD"

# With Invertebrate Mitochondrial Code
translate(code=4)
#[1] "VMHASWQLKCV*VTV*Q"

# With a personal code
translate(charcode="FFLLxxxxYY**CCwwLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRuuuuAAAADDEEGGGG")
#[1] "uMHARwQLKCu*uTu*Q"

# Show what is this code...
showTable(charcode="FFLLxxxxYY**CCwwLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRuuuuAAAADDEEGGGG")
#      [,1]  [,2]
# [1,] "UUU" "F" 
# [2,] "UUC" "F" 
# [3,] "UUA" "L" 
# [4,] "UUG" "L" 
# [5,] "UCU" "x" 
# [6,] "UCC" "x" 
# [7,] "UCA" "x" 
# ...

# Show Standard table:
showTable()

# Show  Invertebrate Mitochondrial Code
showTable(code=4)


}