\name{CompoSeq}
%\alias{compos.seq}
\alias{compoSeq}
\alias{strCompoSeq}
\title{Composition in mono, di or trinucleotides of a sequence}
\description{
  Gives composition in  mono, di or trinucleotides of fragments of a sequence 

  
  Only A, T, G, C are counted, letter as U, X, S, M, N, are counted as
  'X'. Flag "case" specify weather we take into acount letters in lower,
  upper ar all case.
  
}
\usage{
compoSeq(seqno=0, from=1, to=0, strand=getStrand(),
         wsize=1, p=TRUE,case="all",step=wsize)
strCompoSeq(s, wsize=1, p=TRUE,case="all",step=wsize)
}

\arguments{
 \item{seqno}{Integer/scalar, Sequence number (buffer number)}
  \item{s}{String/scalar, A sequence as character string}
 \item{wsize}{Integer/scalar, size of k-uples.}
  \item{from,to}{Integer/scalar, Absolute addresses of the beginning and the end of the fragment,
  (1 means the first nucleotide and 0 conventionally the last one; 
  from must not be larger than to and both vectors must be the same size)}
 \item{strand}{Integer/vector, Strand (forward: 0, reverse: 1)}
 \item{p}{Logical/scalar, If p=TRUE, results are in pourcentages, else, results are
   in counts.}
 \item{case}{String/scalar, Case of the letters taken into account ("all", "upper", "lower")}
 \item{step}{Integer/scalar, Step increment of positions when counting words. }
% \item{limites,comp}{Internal parameters}
}

\value{
  A matrix with nucleotide composition for all regions (NxM where N =
  5*wordSize and M = length(from))

  If error: NULL
}

\note{.Use setStrand by default }


\keyword{utilities}


%\seealso{\code{\link{exact.word}}, \code{\link{make.profile}},
%\code{\link{scan.profile}}}
\seealso{\code{\link{exactWord}}}

\examples{
s<-"CGTACGTAGTAGCTAGCTAGCTAGCTAGCTGATCGATGCTAGCTGATCGATGCT"
placeString(s)
x<-c(1,8,15,50)
y<-c(5,12,19,54)
compoSeq(from =x, to = y,wsize=2)

compoSeq(from =x, to = y,wsize=2,strand=1)

compoSeq(from =x, to = y,wsize=2,step=2,p=FALSE)

}